추천 제품
설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CTGCAAACCAAGACACAGGAACTTGAAACCACTCAGAAACATTTGCAAGAAACAAAATTACAACTGGTTAAAGAGGAATATGTCTCTTCAGCCTTGGAAAGAACCGAGAAGACACTGCATGACACGGCCAGCAAGTTGCTTAACACGGTTAAAGAAACCACCAGGGCTGTATCTGGTCTACATTCTAAACTGGACCGCAAGAGAGCAATCGATGAGCACAACGCTGAAGCTCAGGAGAGCTTTGGCAAAAACCTCAACAGTCTGTTTAATAATATGGAAGAATTGATTAAGGATGGCAGTGCGAAACAAAAGGCCATGCTAGACGTTCATAAGACACTGTTTGGTAACCTGATGTCTTCTAGTGTCTCTGCATTAGACACCATTACCACGACAGCACTTGAATCTCTCGTGTCTATTCCAGAAAATGTGTCCGC
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... KIF11(16551) , Kif11(16551)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Myles Fennell et al.
Assay and drug development technologies, 13(7), 347-355 (2015-08-13)
Uptake of nutrients, such as glucose and amino acids, is critical to support cell growth and is typically mediated by cell surface transporters. An alternative mechanism for the bulk uptake of nutrients from the extracellular space is macropinocytosis, a nonclathrin
Daniel Edinger et al.
Drug delivery and translational research, 4(1), 84-95 (2015-03-20)
Two antitumoral siRNAs (directed against target genes Eg5 and Ran) complexed with one of three sequence-defined cationic oligomers were compared in gene silencing in vitro and antitumoral in vivo efficacy upon intratumoral injection. Two lipo-oligomers (T-shape 49, i-shape 229) and
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.