Passa al contenuto
Merck
Tutte le immagini(2)

Documenti fondamentali

EHU106441

Sigma-Aldrich

MISSION® esiRNA

targeting human PTEN

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

ACCGCCAAATTTAATTGCAGAGTTGCACAATATCCTTTTGAAGACCATAACCCACCACAGCTAGAACTTATCAAACCCTTTTGTGAAGATCTTGACCAATGGCTAAGTGAAGATGACAATCATGTTGCAGCAATTCACTGTAAAGCTGGAAAGGGACGAACTGGTGTAATGATATGTGCATATTTATTACATCGGGGCAAATTTTTAAAGGCACAAGAGGCCCTAGATTTCTATGGGGAAGTAAGGACCAGAGACAAAAAGGGAGTAACTATTCCCAGTCAGAGGCGCTATGTGTATTATTATAGCTACCTGTTAAAGAATCATCTGGATTATAGACCAGTGGCACTGTTGTTTCACAAGATGATGTTTGAAACTATTCCAATGTTCAGTGGCGGAACTTGCAATCCTCAGTTTGTGGTCTGCCAGCTAAAGGTGAAGATATATTCCTCCAATTCAGGACCCACACGACGGGAAGACAAGTTCATGTACTTTGAGTTCCCTCAGCCGTTACCT

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Lei Dou et al.
Frontiers in oncology, 11, 614035-614035 (2021-03-27)
microRNAs (miRNAs) are of great significance in cancer treatment, which may have a desirable result on the regulation of tumorigenesis, progression, recurrence, and chemo-resistance of ovarian cancer. However, the research on the further potential application of miR-4461 in ovarian cancer
Ke Wang et al.
Biochemical and biophysical research communications, 521(3), 652-659 (2019-11-05)
WW domain containing E3 Ub-protein ligase 2 (WWP2) plays an important role in tumor progression as an E3 ligase of PTEN. Here, we investigated the role of WWP2 in gastric cancer (GC). We found that WWP2 is overexpressed in GC
Bo Yuan et al.
OncoTargets and therapy, 13, 9147-9157 (2020-09-29)
Long non-coding RNA (lncRNA) cancer susceptibility candidate 9 (CASC9) has been reported to play a vital role in tumorigenesis. This study explored the biological role of CASC9 and its regulation mechanism in bladder cancer (BC). Gene expression was evaluated using
Zheng Jin et al.
OncoTargets and therapy, 13, 1073-1086 (2020-02-27)
Glioma is the most commonly diagnosed primary brain tumor. Dysregulation of long non-coding RNA (lncRNA) is associated with initiation and development of various cancer types including glioma. The relative expression of lncRNA was analyzed by real time-quantitative polymerase chain reaction
Guang-Tao Yu et al.
Oncotarget, 6(39), 42067-42080 (2015-11-18)
Myeloid-derived suppressor cells (MDSCs) and tumor associated macrophages (TAMs) play key roles in the tumor immune suppressive network and tumor progression. However, precise roles of programmed death-1 (PD-1) in immunological functions of MDSCs and TAMs in head and neck squamous

Articoli

Quantitative and qualitative western blotting to validate knockdown by esiRNA. Sigma-Aldrich.com

Protocolli

Coronavirus qPCR Primer and probe sets for the detection of SARS-CoV-2 (Corona Virus), with additional real-time RT-PCR, RT-qPCR and supporting reagents available.

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.