Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU015451

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Hif1a

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCAGCCTAACAGTCCCAGTGAATATTGCTTTGATGTGGATAGCGATATGGTCAATGTATTCAAGTTGGAACTGGTGGAAAAACTGTTTGCTGAAGACACAGAGGCAAAGAATCCATTTTCAACTCAGGACACTGATTTAGATTTGGAGATGCTGGCTCCCTATATCCCAATGGATGATGATTTCCAGTTACGTTCCTTTGATCAGTTGTCACCATTAGAGAGCAATTCTCCAAGCCCTCCAAGTATGAGCACAGTTACTGGGTTCCAGCAGACCCAGTTACAGAAACCTACCATCACTGCCACTGCCACCACAACTGCCACCACTGATGAATCAAAAACAGAGACGAAGGACAATAAAGAAGATATTAAAATACTGATTGCATCTCCATCTTCTACCCAAGTACCTCAAGAAACGACCACTGCTAAGGC

Ensembl | nº de acceso | ratón

ENSMUSG00000021109

Nº de acceso NCBI

NM_010431

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... HIF1A(15251) , Hif1a(15251)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Qianqian Gao et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 74, 57-62 (2015-09-10)
A major cause of morbidity and mortality in cardiovascular disease is pathological cardiac hypertrophy. With an increase in the cellular surface area and upregulation of the atrial natriuretic peptide (ANP) gene, cardiac hypertrophy is a prominent feature of diabetic cardiomyopathy.
Yong Zhang et al.
Science translational medicine, 7(290), 290ra92-290ra92 (2015-06-05)
Whereas amphibians regenerate lost appendages spontaneously, mammals generally form scars over the injury site through the process of wound repair. The MRL mouse strain is an exception among mammals because it shows a spontaneous regenerative healing trait and so can
Naoki Adachi et al.
Biochemical and biophysical research communications, 463(4), 1176-1183 (2015-06-19)
Poor survival is a major problem of adipocyte transplantation. We previously reported that VEGF and MMPs secreted from transplanted adipocytes are essential for angiogenesis and adipogenesis. Pretreatment with low-dose (5 Gy) radiation (LDR) increased VEGF, MMP-2, and HIF-1 alpha mRNA expression
Alessia Brossa et al.
Oncotarget, 6(13), 11295-11309 (2015-05-08)
Different mechanisms of angiogenesis and vasculogenesis are involved in the development of the tumor vasculature. Among them, cancer stem cells are known to contribute to tumor vasculogenesis through their direct endothelial differentiation. Here, we investigated the effect of anti-angiogenic therapy
Bejan J Saeedi et al.
Molecular biology of the cell, 26(12), 2252-2262 (2015-04-24)
Intestinal epithelial cells (IECs) are exposed to profound fluctuations in oxygen tension and have evolved adaptive transcriptional responses to a low-oxygen environment. These adaptations are mediated primarily through the hypoxia-inducible factor (HIF) complex. Given the central role of the IEC
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico