Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU096311

Sigma-Aldrich

MISSION® esiRNA

targeting human BRCA1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CTTCCCTGCTTCCAACACTTGTTATTTGGTAAAGTAAACAATATACCTTCTCAGTCTACTAGGCATAGCACCGTTGCTACCGAGTGTCTGTCTAAGAACACAGAGGAGAATTTATTATCATTGAAGAATAGCTTAAATGACTGCAGTAACCAGGTAATATTGGCAAAGGCATCTCAGGAACATCACCTTAGTGAGGAAACAAAATGTTCTGCTAGCTTGTTTTCTTCACAGTGCAGTGAATTGGAAGACTTGACTGCAAATACAAACACCCAGGATCCTTTCTTGATTGGTTCTTCCAAACAAATGAGGCATCAGTCTGAAAGCCAGGGAGTTG

Ensembl | nº de acceso humano

ENSG00000012048

Nº de acceso NCBI

NM_007294

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... BRCA1(672) , BRCA1(672)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Eliana Mc Tacconi et al.
EMBO molecular medicine, 9(10), 1398-1414 (2017-07-22)
Maintenance of genome integrity requires the functional interplay between Fanconi anemia (FA) and homologous recombination (HR) repair pathways. Endogenous acetaldehyde, a product of cellular metabolism, is a potent source of DNA damage, particularly toxic to cells and mice lacking the
Wenchao Ji et al.
Biochemical and biophysical research communications, 522(1), 121-126 (2019-11-23)
Lung cancer is the leading cause of cancer death worldwide. PARP inhibitors have become a new line of cancer therapy and a successful demonstration of the synthetic lethality concept. The mechanism and efficacy of PARP inhibitors have been well studied
Rikke D Rasmussen et al.
Nature communications, 7, 13398-13398 (2016-11-16)
Oncogene-evoked replication stress (RS) fuels genomic instability in diverse cancer types. Here we report that BRCA1, traditionally regarded a tumour suppressor, plays an unexpected tumour-promoting role in glioblastoma (GBM), safeguarding a protective response to supraphysiological RS levels. Higher BRCA1 positivity
Oreekha Amin et al.
BMC cancer, 15, 817-817 (2015-10-30)
Impairment of homologous recombination (HR) is found in close to 50 % of ovarian and breast cancer. Tumors with BRCA1 mutations show increased expression of the Insulin-like growth factor type 1 receptor (IGF-1R). We previously have shown that inhibition of
Nadire Duru et al.
Cancer letters, 369(1), 184-191 (2015-08-25)
Breast and lung cancer patients who are treated with radiotherapy often have severe side effects, including radiation-induced lung damage and secondary cancers. Activation of the NRF2 pathway is a well-known mechanism that protects cells against radiation induced oxidative stress, but
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico