EHURLUC
MISSION® esiRNA
targeting RLUC
Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
About This Item
Código UNSPSC:
41105324
NACRES:
NA.51
Productos recomendados
descripción
Powered by Eupheria Biotech
Nivel de calidad
Línea del producto
MISSION®
formulario
lyophilized powder
Condiciones de envío
ambient
temp. de almacenamiento
−20°C
Descripción general
EHURLUC targets Renilla Luciferase. It can be used as a negative control in systems lacking Renilla Luciferase, or a positive knockdown control in systems expressing it.
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Otras notas
esiRNA cDNA target sequence: GATAACTGGTCCGCAGTGGTGGGCCAGATGTAAACAAATGAATGTTCTTGATTCATTTATTAATTATTATGATTCAGAAAAACATGCAGAAAATGCTGTTATTTTTTTACATGGTAACGCGGCCTCTTCTTATTTATGGCGACATGTTGTGCCACATATTGAGCCAGTAGCGCGGTGTATTATACCAGACCTTATTGGTATGGGCAAATCAGGCAAATCTGGTAATGGTTCTTATAGGTTACTTGATCATTACAAATATCTTACTGCATGGTTTGAACTTCTTAATTTACCAAAGAAGATCATTTTTGTCGGCCATGATTGGGGTGCTTGTTTGGCATTTCATTATAGCTATGAGCATCAAGATAAGATCAAAGCAATAGTTCACGCTGAAAGTGTAGTAGATGTGATTGAATCATGGGATGAATGG
Información legal
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Código de clase de almacenamiento
10 - Combustible liquids
Clase de riesgo para el agua (WGK)
WGK 1
Punto de inflamabilidad (°F)
Not applicable
Punto de inflamabilidad (°C)
Not applicable
Certificados de análisis (COA)
Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»
¿Ya tiene este producto?
Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.
Los clientes también vieron
Rachel Elizabeth Miller et al.
Biochemical and biophysical research communications, 500(2), 391-397 (2018-04-15)
PPM1B is a metal-dependent serine/threonine protein phosphatase, with a similar structure and function to the well-known oncogene in breast cancer, PPM1D (WIP1). However, clinical significance of PPM1B as a pharmacological target in cancer therapy has not been explored. To test
6-Dehydrogingerdione restrains lipopolysaccharide-induced inflammatory responses in RAW 264.7 macrophages.
Huang SH, Lee CH, Wang HM, et al.
Journal of Agricultural and Food Chemistry, 62(37), 9171-9179 (2014)
Jonasz Jeremiasz Weber et al.
Neuropharmacology, 133, 94-106 (2018-01-23)
Deciphering the molecular pathology of Huntington disease is of particular importance, not only for a better understanding of this neurodegenerative disease, but also to identify potential therapeutic targets. The polyglutamine-expanded disease protein huntingtin was shown to undergo proteolysis, which results
Bram Piersma et al.
Cell and tissue research, 374(1), 165-175 (2018-05-05)
Mechanosensing of fibroblasts plays a key role in the development of fibrosis. So far, no effective treatments are available to treat this devastating disorder. Spectrins regulate cell morphology and are potential mechanosensors in a variety of non-erythroid cells, but little
Angela Russo et al.
Oncogene, 37(15), 1976-1990 (2018-01-26)
The signaling events involved in the onset of ovarian cancer from the fallopian tube epithelium (FTE) are crucial for early detection and treatment of the disease, but they remain poorly defined. Conditional homozygous knockout of PTEN mediated by PAX8-cre recombinase
Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.
Póngase en contacto con el Servicio técnico