Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU017691

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Kif11

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CTGCAAACCAAGACACAGGAACTTGAAACCACTCAGAAACATTTGCAAGAAACAAAATTACAACTGGTTAAAGAGGAATATGTCTCTTCAGCCTTGGAAAGAACCGAGAAGACACTGCATGACACGGCCAGCAAGTTGCTTAACACGGTTAAAGAAACCACCAGGGCTGTATCTGGTCTACATTCTAAACTGGACCGCAAGAGAGCAATCGATGAGCACAACGCTGAAGCTCAGGAGAGCTTTGGCAAAAACCTCAACAGTCTGTTTAATAATATGGAAGAATTGATTAAGGATGGCAGTGCGAAACAAAAGGCCATGCTAGACGTTCATAAGACACTGTTTGGTAACCTGATGTCTTCTAGTGTCTCTGCATTAGACACCATTACCACGACAGCACTTGAATCTCTCGTGTCTATTCCAGAAAATGTGTCCGC

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Myles Fennell et al.
Assay and drug development technologies, 13(7), 347-355 (2015-08-13)
Uptake of nutrients, such as glucose and amino acids, is critical to support cell growth and is typically mediated by cell surface transporters. An alternative mechanism for the bulk uptake of nutrients from the extracellular space is macropinocytosis, a nonclathrin
Daniel Edinger et al.
Drug delivery and translational research, 4(1), 84-95 (2015-03-20)
Two antitumoral siRNAs (directed against target genes Eg5 and Ran) complexed with one of three sequence-defined cationic oligomers were compared in gene silencing in vitro and antitumoral in vivo efficacy upon intratumoral injection. Two lipo-oligomers (T-shape 49, i-shape 229) and

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico