Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU095481

Sigma-Aldrich

MISSION® esiRNA

targeting human RIF1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GTGGCCACCATGAAGACTTTGCTTAGAACTTGGTCAGAATTATATAGAGCATTTGCTCGTTGTGCTGCTTTGGTGGCAACAGCAGAAGAGAACTTGTGCTGTGAGGAACTTTCTTCCAAGATAATGTCCAGTTTGGAAGATGAAGGCTTTTCTAATTTGTTGTTCGTGGATAGAATTATTTATATTATTACTGTAATGGTTGATTGCATTGACTTCTCACCATATAATATTAAATATCAGCCCAAAGTTAAATCACCACAGAGACCTTCAGATTGGTCCAAAAAGAAGAATGAGCCCCTAGGGAAA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Shin-Ichiro Hiraga et al.
EMBO reports, 18(3), 403-419 (2017-01-13)
The human RIF1 protein controls DNA replication, but the molecular mechanism is largely unknown. Here, we demonstrate that human RIF1 negatively regulates DNA replication by forming a complex with protein phosphatase 1 (PP1) that limits phosphorylation-mediated activation of the MCM
Sylvie M Noordermeer et al.
Nature, 560(7716), 117-121 (2018-07-20)
53BP1 is a chromatin-binding protein that regulates the repair of DNA double-strand breaks by suppressing the nucleolytic resection of DNA termini1,2. This function of 53BP1 requires interactions with PTIP3 and RIF14-9, the latter of which recruits REV7 (also known as
Satish Sati et al.
Molecular cell, 78(3), 522-538 (2020-03-30)
To understand the role of the extensive senescence-associated 3D genome reorganization, we generated genome-wide chromatin interaction maps, epigenome, replication-timing, whole-genome bisulfite sequencing, and gene expression profiles from cells entering replicative senescence (RS) or upon oncogene-induced senescence (OIS). We identify senescence-associated heterochromatin
Osama M Ahmed et al.
Cell reports, 27(9), 2527-2536 (2019-05-30)
Genetically wired neural mechanisms inhibit mating between species because even naive animals rarely mate with other species. These mechanisms can evolve through changes in expression or function of key genes in sensory pathways or central circuits. Gr32a is a gustatory

Global Trade Item Number

Número de referencia del producto (SKU)GTIN
EHU095481-20UG4061831356533
EHU095481-50UG4061831374216

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico