Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU063791

Sigma-Aldrich

MISSION® esiRNA

targeting human LMNA

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ACCAAGAAGGAGGGTGACCTGATAGCTGCTCAGGCTCGGCTGAAGGACCTGGAGGCTCTGCTGAACTCCAAGGAGGCCGCACTGAGCACTGCTCTCAGTGAGAAGCGCACGCTGGAGGGCGAGCTGCATGATCTGCGGGGCCAGGTGGCCAAGCTTGAGGCAGCCCTAGGTGAGGCCAAGAAGCAACTTCAGGATGAGATGCTGCGGCGGGTGGATGCTGAGAACAGGCTGCAGACCATGAAGGAGGAACTGGACTTCCAGAAGAACATCTACAGTGAGGAGCTGCGTGAGACCAAGCGCCGTCATGAGACCCGACTGGTGGAGATTGACAATGGGAAGCAGCGTGAGTTTGAGAGCCGGCTGGCGGATGCGCTGCAGGAACTGCGGGCCCAGCATGAGGACCAGGTGGAGCAGTA

Ensembl | nº de acceso humano

ENSG00000160789

Nº de acceso NCBI

NM_005572
NM_170707
NM_170708

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... LMNA(4000) , LMNA(4000)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Berta N Vazquez et al.
Nucleic acids research, 47(15), 7870-7885 (2019-06-22)
Long interspersed elements-1 (LINE-1, L1) are retrotransposons that hold the capacity of self-propagation in the genome with potential mutagenic outcomes. How somatic cells restrict L1 activity and how this process becomes dysfunctional during aging and in cancer cells is poorly
Paraskevi Sakellariou et al.
Skeletal muscle, 6, 4-4 (2016-03-01)
Studies of the pathogenic mechanisms underlying human myopathies and muscular dystrophies often require animal models, but models of some human diseases are not yet available. Methods to promote the engraftment and development of myogenic cells from individuals with such diseases
Qiao Zhang et al.
Molecular biology of the cell, 30(7), 899-906 (2018-12-20)
Cancer cell migration through narrow constrictions generates compressive stresses on the nucleus that deform it and cause rupture of nuclear membranes. Nuclear membrane rupture allows uncontrolled exchange between nuclear and cytoplasmic contents. Local tensile stresses can also cause nuclear deformations
Camilla Evangelisti et al.
Cells, 9(3) (2020-04-03)
A type lamins are fundamental components of the nuclear lamina. Changes in lamin A expression correlate with malignant transformation in several cancers. However, the role of lamin A has not been explored in osteosarcoma (OS). Here, we wanted to investigate
Mariana Reis-Sobreiro et al.
Cancer research, 78(21), 6086-6097 (2018-08-30)
Abnormalities in nuclear shape are a well-known feature of cancer, but their contribution to malignant progression remains poorly understood. Here, we show that depletion of the cytoskeletal regulator, Diaphanous-related formin 3 (DIAPH3), or the nuclear membrane-associated proteins, lamin A/C, in
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico