Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EMU052501

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Prkaa2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GCTGTGGATCGCCAAATTATGCAGCACCTGAGGTCATCTCAGGAAGGCTGTATGCAGGTCCCGAGGTCGATATCTGGAGCTGTGGTGTCATCCTGTATGCCCTTCTCTGTGGCACCCTCCCTTTCGATGATGAGCACGTGCCTACGCTCTTCAAGAAGATCCGAGGGGGTGTGTTTTACATCCCAGACTATCTCAACCGTTCTGTCGCCACTCTGCTGATGCACATGCTCCAGGTGGACCCCCTGAAGCGAGCGACTATCAAAGACATACGAGAACATGAATGGTTTAAACAGGATTTGCCCAGCTACCTATTTCCTGAAGACCCCTCCTACGATGCGAATGTCATTGTCGATGAGGCTGTGAAGGAAGTCTGTGAGAAATTCGAGTGTACAGAGTCAGAAGTGATGAATAGTCTGTATAGTGGTGACCCTCAAGACCAGCTTGCAGTGGCTTAT

N° accesso Ensembl | topo

ENSMUSG00000028518

N° accesso NCBI

NM_178143

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

mouse ... PRKAA2(108079) , Prkaa2(108079)

Categorie correlate

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Sreevidya Santha et al.
The Journal of biological chemistry, 290(36), 21865-21875 (2015-07-23)
Prostate cancer (PCa) is one of the most frequently diagnosed cancers in men with limited treatment options for the hormone-resistant forms. Development of novel therapeutic options is critically needed to target advanced forms. Here we demonstrate that combinatorial treatment with
Sravanth K Hindupur et al.
Breast cancer research : BCR, 16(4), 420-420 (2014-08-07)
Matrix detachment triggers anoikis, a form of apoptosis, in most normal epithelial cells, while acquisition of anoikis resistance is a prime requisite for solid tumor growth. Of note, recent studies have revealed that a small population of normal human mammary
Xia Cao et al.
Hypertension research : official journal of the Japanese Society of Hypertension, 37(9), 803-810 (2014-06-27)
The purpose of this study was to determine the effects of resveratrol (RSV) and the molecular mechanisms by which it regulates vascular smooth muscle contraction and blood pressure in mice. In cultured human vascular smooth muscle cells (VSMCs), we found
Teraneh Z Jhaveri et al.
Oncotarget, 6(17), 14754-14765 (2015-07-06)
AMP-activated Protein Kinase (AMPK) activity retards growth of many types of cancers. Investigating effects of AMPK activation on breast cancer cell signaling and survival, we found that breast cancer cell lines with amplification and over-expression of HER2 or EGFR are
Chiara Zucal et al.
BMC cancer, 15, 855-855 (2015-11-07)
Nicotinamide phosphoribosyltransferase (NAMPT), the rate-limiting enzyme in NAD(+) biosynthesis from nicotinamide, is one of the major factors regulating cancer cells metabolism and is considered a promising target for treating cancer. The prototypical NAMPT inhibitor FK866 effectively lowers NAD(+) levels in

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.