Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EMU030461

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Gtf2h1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GAAGAAGCAGGATGGAGCACTGTACCTCATGGCAGAGAGAATTGCTTGGGCACCTGAAGGCAAAGACAGATTTACAATCAGCCATATGTATGCAGATATTAAATGCCAGAAAATCAGTCCAGAGGGAAAAGCTAAAATACAACTTCAGCTGGTCCTGCATGCAGGGGACACAACAAACTTCCATTTTTCCAACGAAAGCACGGCAGTGAAAGAACGGGATGCAGTGAAGGACCTCCTTCAGCAGCTGCTGCCCAAGTTCAAGCGGAAAGCTAATAAAGAGCTGGAGGAGAAGAACAGAATGCTCCAAGAAGATCCTGTTTTATTCCAACTCTATAAAGACCTTGTTGTGAGCCAAGTGTTCAGTGCTGAGGAATTCTGGGCCAATCGTTTAAATGTGAATGCAACAGATAGTTCTACATCCAGTCACAAGCAGGATGTTGGTATTTCTGCAGCATTTCTGGCTGATGTCC

N° accesso Ensembl | topo

ENSMUSG00000006599

N° accesso NCBI

NM_008186

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

mouse ... GTF2H1(14884) , Gtf2h1(14884)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Leticia M Ignacio-Souza et al.
Endocrinology, 155(8), 2831-2844 (2014-06-04)
In both human and experimental obesity, inflammatory damage to the hypothalamus plays an important role in the loss of the coordinated control of food intake and energy expenditure. Upon prolonged maintenance of increased body mass, the brain changes the defended
Kaori Kojima et al.
Neuroscience letters, 581, 37-41 (2014-08-26)
p62, which is also called sequestosome 1 (SQSTM1), plays a critical role in neuronal cell death. However, the role of p62 in axonal degeneration remains unclear. We evaluated whether the modulation of p62 expression may affect axonal loss in tumor
Young-Ok Son et al.
The Journal of biological chemistry, 289(41), 28660-28675 (2014-08-27)
The cadmium-transformed human lung bronchial epithelial BEAS-2B cells exhibit a property of apoptosis resistance as compared with normal non-transformed BEAS-2B cells. The level of basal reactive oxygen species (ROS) is extremely low in transformed cells in correlation with elevated expressions
Young-Ok Son et al.
The Journal of biological chemistry, 290(45), 27090-27100 (2015-09-20)
Arsenic (As(3+)) is a carcinogen with considerable environmental and occupational relevancy. The present study shows that As(3+)-transformed human lung bronchial epithelial BEAS-2B cells (AsT cells) exhibit the property of apoptosis resistance. The level of basal reactive oxygen species (ROS) is
Ashwani Khurana et al.
Oncotarget, 6(34), 36354-36369 (2015-10-27)
A promising new strategy for cancer therapy is to target the autophagic pathway. In the current study, we demonstrate that the antimalarial drug Quinacrine (QC) reduces cell viability and promotes chemotherapy-induced cell death in an autophagy-dependent manner more extensively in

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.