Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EMU023701

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Nox4

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CTGGAAGAACCCAAGTTCCAAGCTCATTTCCCACAGACCTGGATTTGGATTTCTGGACCTTTGTGCCTTTATTGTGCGGAGAGACTTTACCGATGCATCAGGAGCAACAAACCTGTCACCATCATCTCAGTCATCAATCATCCCTCTGATGTAATGGAACTCCGTATGATCAAAGAAAACTTTAAAGCAAGACCTGGCCAGTATATTATTCTCCATTGCCCCAGTGTATCAGCATTAGAAAACCACCCATTTACTCTCACAATGTGTCCTACTGAAACCAAAGCAACATTTGGTGTCCACTTTAAAGTAGTAGGAGACTGGACAGAACGATTCCGGGATTTGCTACTGCCTCCATCAAGTCAAGACTCTGAGATTCTGCCCTTCATTCACTCTAGAAATTACCCTAAGTTATACATTGATGGTCCATTTGGAAGCCCATTTGAGGAGTCA

N° accesso Ensembl | topo

ENSMUSG00000030562

N° accesso NCBI

NM_015760

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

mouse ... NOX4(50490) , Nox4(50490)

Categorie correlate

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
PBS
AOR

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Aleksandr E Vendrov et al.
Antioxidants & redox signaling, 23(18), 1389-1409 (2015-06-10)
Increased oxidative stress and vascular inflammation are implicated in increased cardiovascular disease (CVD) incidence with age. We and others demonstrated that NOX1/2 NADPH oxidase inhibition, by genetic deletion of p47phox, in Apoe(-/-) mice decreases vascular reactive oxygen species (ROS) generation
Motoya Tanaka et al.
Oncology reports, 34(4), 1726-1732 (2015-08-05)
Malignant pleural mesothelioma (MPM) is an aggressive tumor that is characterized by dysregulated growth and resistance to apoptosis. Reactive oxygen species (ROS)-generating NADPH oxidase (Nox) family enzymes have been suggested to be involved in neoplastic proliferation. Both the antioxidant N-acetylcysteine
Jin-Ran Chen et al.
The Journal of biological chemistry, 290(23), 14692-14704 (2015-04-30)
Bone remodeling is age-dependently regulated and changes dramatically during the course of development. Progressive accumulation of reactive oxygen species (ROS) has been suspected to be the leading cause of many inflammatory and degenerative diseases, as well as an important factor
Qian Jiang et al.
PloS one, 9(9), e107135-e107135 (2014-09-10)
Our previous studies demonstrated that bone morphogenetic protein 4 (BMP4) mediated, elevated expression of canonical transient receptor potential (TRPC) largely accounts for the enhanced proliferation in pulmonary arterial smooth muscle cells (PASMCs). In the present study, we sought to determine
Cheng-Chang Yeh et al.
Clinical oral investigations, 19(6), 1463-1471 (2014-12-04)
Triethylene glycol dimethacrylate (TEGDMA) is a common component of resin-based dental composites and endodontic sealers. TEGDMA induces apoptosis in several types of cells. However, the mechanisms are not completely understood. The aim of this study was to investigate the mechanisms
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.