Passa al contenuto
Merck
Tutte le immagini(2)

Documenti fondamentali

EHU135281

Sigma-Aldrich

MISSION® esiRNA

targeting human BCL2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CGGCCTCTGTTTGATTTCTCCTGGCTGTCTCTGAAGACTCTGCTCAGTTTGGCCCTGGTGGGAGCTTGCATCACCCTGGGTGCCTATCTGGGCCACAAGTGAAGTCAACATGCCTGCCCCAAACAAATATGCAAAAGGTTCACTAAAGCAGTAGAAATAATATGCATTGTCAGTGATGTACCATGAAACAAAGCTGCAGGCTGTTTAAGAAAAAATAACACACATATAAACATCACACACACAGACAGACACACACACACACAACAATTAACAGTCTTCAGGCAAAACGTCGAATCAGCTATTTACTGCCAAAGGGAAATATCATTTATTTTTTACATTATTAAGAAAAAAAGATTTATTTATTTAAGACAGTCCCATCAAAACTCCTGTCTTTGGAAATCCGACCACTAATTGCCAAGCACC

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Ya'nan Yang et al.
OncoTargets and therapy, 12, 897-906 (2019-02-19)
Peritoneal metastasis is the most common pathway for the spread of ovarian cancer. Ovarian cancer cells in ascites prefer to aggregate into the more chemoresistant multicellular spheroids (MCSs), leading to treatment failure and disease recurrence. We previously established a suspension
Jianxu Zhang et al.
International journal of nanomedicine, 12, 4721-4732 (2017-07-26)
Herein, DNA duplex was constructed through the hybridization of adenosine triphosphate (ATP)-responsive aptamer and its cDNA in which GC-rich motif could be used to load doxorubicin (DOX), and then, cationic polymer PEI25K was used as a carrier to simultaneously condense
Kangcheng Zhao et al.
Gene, 628, 259-266 (2017-07-19)
Accumulating evidence indicates that microRNAs can regulate the apoptosis of various cells. Apoptosis of nucleus pulposus cells plays an important role in the progression of intervertebral disc degeneration. The aim of this study is to investigate whether microRNA-143 (miRNA-143) is
Tian-Quan Yang et al.
OncoTargets and therapy, 10, 4305-4313 (2017-09-19)
Glioma is one of the most common types of adult primary brain tumors, and the underlying molecular mechanisms still remain unclear. Nuclear factor-kappa B1 (NF-κB1) is involved in a variety of malignancies and is widely expressed in malignant tumors. However
Mingzhu Liu et al.
Cancer biology & therapy, 19(5), 391-399 (2018-01-18)
HOX transcript antisense RNA (HOTAIR) is a long non-coding RNA (lncRNA) widely involved in the progression of numerous malignancies. Whereas, the potential molecular mechanism of HOTAIR involved in cervical cancer progression is still needed to be elaborated. The expression of

Articoli

Quantitative and qualitative western blotting to validate knockdown by esiRNA. Sigma-Aldrich.com

Global Trade Item Number

SKUGTIN
EHU135281-50UG4061831375664
EHU135281-20UG4061831364590

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.