Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU080681

Sigma-Aldrich

MISSION® esiRNA

targeting human MAPK9

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GCAAACCTGTCAGCATTGAAGGAACTCTCACCTCCGTGGGCCTGAAATGCTTGGGAGTTGATGGAACCAAATAGAAAAACTCCATGTTCTGCATGTAAGAAACACAATGCCTTGCCCTACTCAGACCTGATAGGATTGCCTGCTTAGATGATAAAATGAGGCAGAATATGTCTGAAGAAAAAAATTGCAAGCCACACTTCTAGAGATTTTGTTCAAGATCATTTCAGGTGAGCAGTTAGAGTAGGTGAATTTGTTTCAAATTGTACTAGTGACAGTTTCTCATCATCTGTAACTGTTGAGATGTATGTGCATGTGACCACAAATGCTTGCTTGGACTTGCCCATCTAGCACTTTGGAAATCAGTATTTAAATGCCAAATAATCTTCCAGGTAGTGCTGCTTCTG

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Leon Caly et al.
Biochemical and biophysical research communications, 483(1), 64-68 (2017-01-08)
Respiratory syncytial virus (RSV) is a major cause of respiratory infections in infants and the elderly, leading to more deaths than influenza each year worldwide. With no RSV antiviral or efficacious vaccine currently available, improved understanding of the host-RSV interaction
Takouhie Mgrditchian et al.
Proceedings of the National Academy of Sciences of the United States of America, 114(44), E9271-E9279 (2017-10-29)
While blocking tumor growth by targeting autophagy is well established, its role on the infiltration of natural killer (NK) cells into tumors remains unknown. Here, we investigate the impact of targeting autophagy gene Beclin1 (BECN1) on the infiltration of NK
Ting Li et al.
Acta pharmacologica Sinica, 36(12), 1503-1513 (2015-11-26)
Platycodin D, the main saponin isolated from Chinese herb Platycodonis Radix, exhibits anticancer activities against various cancer cell lines. Here we evaluated its anticancer action against human hepatocellular carcinoma cells in vitro and in vivo, and elucidated the relationship between

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.