Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EMU074451

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Mapk8

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CCATCATGAGCAGAAGCAAACGTGACAACAATTTTTATAGTGTAGAGATTGGAGATTCTACATTCACAGTCCTAAAACGATACCAGAATTTAAAGCCTATAGGCTCAGGAGCTCAAGGAATAGTGTGTGCAGCTTATGATGCCATTCTTGAAAGAAATGTTGCAATCAAGAAGCTCAGCCGGCCATTTCAGAATCAGACCCATGCTAAGCGCGCCTACCGAGAACTAGTTCTTATGAAGTGTGTTAATCACAAAAATATAATTGGCCTTTTGAATGTTTTCACACCACAGAAATCCCTAGAAGAATTTCAAGATGTTTACATAGTCATGGAGCTCATGGATGCAAATCTTTGCCAAGTGATTCAGATGGAGTTAGATCATGAAAGAATGTCCTACCTTCTCTATCAAATGCTGTGTGGAATCAAGCACCTTCACTCTGCTG

Ensembl | Número de adesão de camundongo

ENSMUSG00000021936

nº de adesão NCBI

NM_016700

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... MAPK8(26419) , Mapk8(26419)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

12 - Non Combustible Liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Xu Qin et al.
Molecular carcinogenesis, 53(7), 526-536 (2013-01-30)
The c-Jun NH2 -terminal kinase (JNK) signal pathway has been implicated in the growth, cellular proliferation, and apoptosis in many kinds of carcinomas. However, the role of JNK in the development of esophageal squamous cell carcinomas (ESCCs) is unknown. To
Shantel Olivares et al.
PloS one, 9(7), e103828-e103828 (2014-08-01)
Endoplasmic reticulum (ER) stress is induced in many forms of chronic liver disease and may promote the development of hepatocellular carcinoma. The activator protein 1 (AP-1) complex is a transcription factor that promotes hepatic carcinogenesis in response to cellular stress.
Wen-Pin Cheng et al.
PloS one, 10(4), e0123235-e0123235 (2015-04-22)
The expression of TRB3 (tribbles 3), an apoptosis regulated gene, increases during endoplasmic reticulum (ER) stress. How mechanical stress affects the regulation of TRB3 in cardiomyocytes during apoptosis is not fully understood. An in vivo model of aorta-caval shunt in
Wen-Tsong Hsieh et al.
Journal of neuro-oncology, 118(2), 257-269 (2014-04-24)
Glioblastoma multiforme (GBM) is the most common and lethal type of primary brain tumor characterized by its rapid infiltration to surrounding tissues during the early stages. The fast spreading of GBM obscures the initiation of the tumor mass making the
S Goda et al.
International endodontic journal, 48(12), 1122-1128 (2014-11-14)
To investigate the effects of the c-Jun N-terminal kinase (JNK1/2) on the inflammation cytokine tumour necrosis factor-alpha (TNF-α)-enhanced production of matrix metalloproteinase-3 (MMP-3) in human dental pulp fibroblast-like cells (HPFs). HPFs were grown from pulp explants from healthy donors. Primary
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica