Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU055721

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Akt3

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CGGACGGGAATAAGTTCCTTTCAGTCTGTTTCTACACTGTCATCTTAGACTTTGCCTGAGACTGATTCCTGGACATCTCTACCAGTCCTCGCTCTTACAGTTAGCAGGGGCACCTTCTGACATCCCTGACCAGCCAAGGGTCTTCACCCTCACCACCTTTCACTCACATGAAACCATATACACAGACACTCCAGTTTTGTTTTTGCATGAAATTGTATCTCAGTCTAAGGTCTCATGCTGTTGCTGCTACTGTCTTACTATTATAGCAACCTTCAGAAGTAATTTCACAATCTTTGGGAGTCATGAGCCCATTGTTCATTTGTGCATCAAGTGTCATCTTTTGGTTTTTGGTTTTCCCTAGCAGTGAAGGCTAAATGAGATACACTGATTCTAGGTACATTGTTAACTTTCTAGGAGATAAATCAAGAACTAATTAGACTAAGAAGATTTAGTTTATATTTCTGAACAAGCAATTGTTGAAGGGTGGTGGTG

Ensembl | Número de adesão de camundongo

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

X Qian et al.
Oncogene, 33(26), 3411-3421 (2013-08-27)
N-cadherin and HER2/neu were found to be co-expressed in invasive breast carcinomas. To test the contribution of N-cadherin and HER2 in mammary tumor metastasis, we targeted N-cadherin expression in the mammary epithelium of the MMTV-Neu mouse. In the context of
Jade Peres et al.
Oncotarget, 6(3), 1821-1833 (2015-01-18)
The AKT3 signalling pathway plays a critical role in melanoma formation and invasion and components of this signalling cascade are therefore attractive targets for the treatment of malignant melanoma. Recent evidence show that the embryonically important TBX3 transcription factor is

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica