Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU015451

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Hif1a

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CCAGCCTAACAGTCCCAGTGAATATTGCTTTGATGTGGATAGCGATATGGTCAATGTATTCAAGTTGGAACTGGTGGAAAAACTGTTTGCTGAAGACACAGAGGCAAAGAATCCATTTTCAACTCAGGACACTGATTTAGATTTGGAGATGCTGGCTCCCTATATCCCAATGGATGATGATTTCCAGTTACGTTCCTTTGATCAGTTGTCACCATTAGAGAGCAATTCTCCAAGCCCTCCAAGTATGAGCACAGTTACTGGGTTCCAGCAGACCCAGTTACAGAAACCTACCATCACTGCCACTGCCACCACAACTGCCACCACTGATGAATCAAAAACAGAGACGAAGGACAATAAAGAAGATATTAAAATACTGATTGCATCTCCATCTTCTACCCAAGTACCTCAAGAAACGACCACTGCTAAGGC

Ensembl | Número de adesão de camundongo

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Qianqian Gao et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 74, 57-62 (2015-09-10)
A major cause of morbidity and mortality in cardiovascular disease is pathological cardiac hypertrophy. With an increase in the cellular surface area and upregulation of the atrial natriuretic peptide (ANP) gene, cardiac hypertrophy is a prominent feature of diabetic cardiomyopathy.
Yong Zhang et al.
Science translational medicine, 7(290), 290ra92-290ra92 (2015-06-05)
Whereas amphibians regenerate lost appendages spontaneously, mammals generally form scars over the injury site through the process of wound repair. The MRL mouse strain is an exception among mammals because it shows a spontaneous regenerative healing trait and so can
Naoki Adachi et al.
Biochemical and biophysical research communications, 463(4), 1176-1183 (2015-06-19)
Poor survival is a major problem of adipocyte transplantation. We previously reported that VEGF and MMPs secreted from transplanted adipocytes are essential for angiogenesis and adipogenesis. Pretreatment with low-dose (5 Gy) radiation (LDR) increased VEGF, MMP-2, and HIF-1 alpha mRNA expression
Alessia Brossa et al.
Oncotarget, 6(13), 11295-11309 (2015-05-08)
Different mechanisms of angiogenesis and vasculogenesis are involved in the development of the tumor vasculature. Among them, cancer stem cells are known to contribute to tumor vasculogenesis through their direct endothelial differentiation. Here, we investigated the effect of anti-angiogenic therapy
Bejan J Saeedi et al.
Molecular biology of the cell, 26(12), 2252-2262 (2015-04-24)
Intestinal epithelial cells (IECs) are exposed to profound fluctuations in oxygen tension and have evolved adaptive transcriptional responses to a low-oxygen environment. These adaptations are mediated primarily through the hypoxia-inducible factor (HIF) complex. Given the central role of the IEC

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica