About This Item
Código UNSPSC:
41105324
NACRES:
NA.51
Produtos recomendados
descrição
Powered by Eupheria Biotech
Nível de qualidade
linha de produto
MISSION®
forma
lyophilized powder
Condições de expedição
ambient
temperatura de armazenamento
−20°C
Categorias relacionadas
Descrição geral
EHUFLUC targets Firefly Luciferase. It can be used as a negative control in systems lacking Firefly Luciferase, or a positive knockdown control in systems expressing it.
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Outras notas
esiRNA cDNA target sequence: GAGCAACTGCATAAGGCTATGAAGAGATACGCCCTGGTTCCTGGAACAATTGCTTTTACAGATGCACATATCGAGGTGGACATCACTTACGCTGAGTACTTCGAAATGTCCGTTCGGTTGGCAGAAGCTATGAAACGATATGGGCTGAATACAAATCACAGAATCGTCGTATGCAGTGAAAACTCTCTTCAATTCTTTATGCCGGTGTTGGGCGCGTTATTTATCGGAGTTGCAGTTGCGCCCGCGAACGACATTTATAATGAACGTGAATTGCTCAACAGTATGGGCATTTCGCAGCCTACCGTGGTGTTCGTTTCCAAAAAGGGGTTGCAAAAAATTTTGAACGTGCAAAAAAAGCTCCCAATCATCCAAAAAATTATTATCATGGATTCTAAAACGGATTACCAGGGATTTCAGTCGATGTACACGTTCGTCACATCTCATCTACCTCCCGGTTTTAATGAATACGATTTTGTGCCAGAGTCCTTCGATAGGGACAAGACAATTGCACTGATCATGAACTCCTCTGGATCTACTGGTCTGCCTAAAGGTGTCGCTCTGCCTCATAGAACTGCCTGCGTGAGATT
Informações legais
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Código de classe de armazenamento
10 - Combustible liquids
Classe de risco de água (WGK)
WGK 1
Ponto de fulgor (°F)
Not applicable
Ponto de fulgor (°C)
Not applicable
Certificados de análise (COA)
Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.
Já possui este produto?
Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.
Os clientes também visualizaram
Ann Hammarstedt et al.
Scientific reports, 8(1), 15757-15757 (2018-10-27)
Adipose tissue dysfunction is considered an important contributor to systemic insulin resistance and Type 2 diabetes (T2D). Recently, a novel family of endogenous lipids, palmitic acid hydroxy stearic acids (PAHSAs), was discovered. These have anti-diabetic and anti-inflammatory effects in mice
Noelia Luna-Peláez et al.
Cell death & disease, 10(8), 548-548 (2019-07-20)
Mutations in NIPBL are the major cause of Cornelia de Lange Syndrome (CdLS). NIPBL is the cohesin-loading factor and has recently been associated with the BET (bromodomains and extra-terminal (ET) domain) proteins BRD2 and BRD4. Related to this, a CdLS-like
Laura Lee et al.
PloS one, 14(5), e0213116-e0213116 (2019-05-22)
The mitochondrial outer membrane protein Mitochondrial Fission Factor (Mff) plays a key role in both physiological and pathological fission. It is well established that at stressed or functionally impaired mitochondria, PINK1 recruits the ubiquitin ligase Parkin which ubiquitinates Mff and
Annamaria Morotti et al.
Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 35(12), 2423-2431 (2020-08-12)
A role for long non-coding RNAs (lncRNAs) in endocrine cancer pathogenesis is emerging. However, knowledge regarding their expression pattern, correlation with known genetic defects, and clinical implications in parathyroid tumors is still unclear. Here, we profiled 90 known lncRNAs in
Theodora Saridaki et al.
Journal of neurochemistry, 146(4), 474-492 (2018-05-11)
Parkinson's disease can be caused by mutations in the α-synuclein gene and is characterized by aggregates of α-synuclein protein. We have previously shown that over-expression of the small GTPase Rab7 can induce clearance of α-synuclein aggregates. In this study, we
Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.
Entre em contato com a assistência técnica