About This Item
Código UNSPSC:
41105324
NACRES:
NA.51
Produtos recomendados
descrição
Powered by Eupheria Biotech
linha de produto
MISSION®
forma
lyophilized powder
Condições de expedição
ambient
temperatura de armazenamento
−20°C
Descrição geral
EHUEGFP targets enhanced Green Fluorescent Protein (i.e. eGFP). It can be used as a negative control in systems lacking eGFP, or a positive knockdown control in systems expressing it.
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Outras notas
esiRNA cDNA target sequence: GTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTA
Informações legais
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Código de classe de armazenamento
10 - Combustible liquids
Ponto de fulgor (°F)
Not applicable
Ponto de fulgor (°C)
Not applicable
Certificados de análise (COA)
Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.
Já possui este produto?
Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.
Os clientes também visualizaram
Shalaka Chitale et al.
Nucleic acids research, 45(10), 5901-5912 (2017-04-13)
Repair of damaged DNA relies on the recruitment of DNA repair factors in a well orchestrated manner. As a prerequisite, the chromatin needs to be decondensed by chromatin remodelers to allow for binding of repair factors and for DNA repair
Lin Zhou et al.
Zygote (Cambridge, England), 24(1), 89-97 (2015-02-13)
ING2 (inhibitor of growth protein-2) is a member of the ING-gene family and participates in diverse cellular processes involving tumor suppression, DNA repair, cell cycle regulation, and cellular senescence. As a subunit of the Sin3 histone deacetylase complex co-repressor complex
Aman Kumar et al.
Molecular biology reports, 47(9), 7273-7276 (2020-08-06)
NLRP3 pathway plays a vital role in the pathogenesis of different human cancers but still the regulation of NLRP3 pathway largely unknown. Therefore, we examined the levels of NLRP3 and its downstream components (caspase-1 and IL-1β) and its relationship with
Milica Momcilovic et al.
Cancer cell, 33(5), 905-921 (2018-05-16)
Altered metabolism is a hallmark of cancer growth, forming the conceptual basis for development of metabolic therapies as cancer treatments. We performed in vivo metabolic profiling and molecular analysis of lung squamous cell carcinoma (SCC) to identify metabolic nodes for therapeutic
Aman Kumar et al.
Scientific reports, 9(1), 8189-8189 (2019-06-05)
Renal cell carcinoma (RCC) is the leading cause among cancer-related deaths due to urological cancers, which results in response to combination of genetic and epigenetic factors. Histone methylations have been implicated in renal tumorigenesis but their clinical significance and underlying
Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.
Entre em contato com a assistência técnica