Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU109221

Sigma-Aldrich

MISSION® esiRNA

targeting human TARDBP

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

ATGCCGAACCTAAGCACAATAGCAATAGACAGTTAGAAAGAAGTGGAAGATTTGGTGGTAATCCAGGTGGCTTTGGGAATCAGGGTGGATTTGGTAATAGCAGAGGGGGTGGAGCTGGTTTGGGAAACAATCAAGGTAGTAATATGGGTGGTGGGATGAACTTTGGTGCGTTCAGCATTAATCCAGCCATGATGGCTGCCGCCCAGGCAGCACTACAGAGCAGTTGGGGTATGATGGGCATGTTAGCCAGCCAGCAGAACCAGTCAGGCCCATCGGGTAATAACCAAAACCAAGGCAACATGCAGAGGGAGCCAAACCAGGCCTTCGGTTCTGGAAATAACTCTTATAGTGGCTCTAATTCTGGTGCAGCAATTGGTTGGGGATCAGCATCCAATGCAGGGTCGGGCAGTGGTTTTAATGGAGGCTTTGGCTCAAGCATGGATTCTAAGTCTTCTGGCTGGGGAATGTAGAC

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

12 - Non Combustible Liquids

Classe de risco de água (WGK)

WGK 1

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Xiaowei Chen et al.
Protein & cell, 9(10), 848-866 (2017-09-28)
Aberrant regulation of miRNA genes contributes to pathogenesis of a wide range of human diseases, including cancer. The TAR DNA binding protein 43 (TDP-43), a RNA/DNA binding protein associated with neurodegeneration, is involved in miRNA biogenesis. Here, we systematically examined
Seiichi Nagano et al.
Acta neuropathologica, 140(5), 695-713 (2020-08-18)
Mislocalization and abnormal deposition of TDP-43 into the cytoplasm (TDP-43 proteinopathy) is a hallmark in neurons of amyotrophic lateral sclerosis (ALS) and frontotemporal lobar degeneration (FTLD). However, the pathogenic mechanism of the diseases linked to TDP-43 is largely unknown. We
Michael E Ward et al.
The Journal of experimental medicine, 211(10), 1937-1945 (2014-08-27)
Frontotemporal dementia (FTD) is the most common cause of dementia in people under 60 yr of age and is pathologically associated with mislocalization of TAR DNA/RNA binding protein 43 (TDP-43) in approximately half of cases (FLTD-TDP). Mutations in the gene
Giuseppe Militello et al.
Journal of molecular cell biology, 10(2), 102-117 (2018-04-05)
Myogenesis is a complex process required for skeletal muscle formation during embryonic development and for regeneration and growth of myofibers in adults. Accumulating evidence suggests that long non-coding RNAs (lncRNAs) play key roles in regulating cell fate decision and function
Alexander Gulliver Bjørnholt Grønning et al.
Nucleic acids research, 48(13), 7099-7118 (2020-06-20)
Nucleotide variants can cause functional changes by altering protein-RNA binding in various ways that are not easy to predict. This can affect processes such as splicing, nuclear shuttling, and stability of the transcript. Therefore, correct modeling of protein-RNA binding is

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica