Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU107101

Sigma-Aldrich

MISSION® esiRNA

targeting human PPIA

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TGGTGTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGGAGCGCTTTGGGTCCAGGAATGGCAAGACCAGCAAGAAGATCACCATTGCTGACTGTGGACAACTCGAATAAGTTTGACTTGTGTTTTATCTTAACCACCAGATCATTCCTTCTGTAGCTCAGGAGAGCACCCCTCCACCCCATTTGCTCGCAGTATCCTAGAATCTTTGTGCTCTCGCTGCAGTTCCCTTTGGGTTCCATGTTTTCCTTGTTCCCTCCCATGCCTAGCTGGATTGCAGAGTTAAGTTTATGATTATGAAATAAAAACTAAATAACAATTGTCCTCGTTTGAGTTAAGAGTGTTGATGTAGGCTTTATTTTAAGCAGTAATGGGTTACTTCTGAAACATCACTTGTTTGCTTAATTCTACACAGTACTTAGATTTTTTTTACTTTCCAGTCCCAGGAAGTGTCAATGTTTGTTGAGTGGAATATTGAAAATGTAGGCAGCAACTGGG

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

N Doti et al.
Cell death & disease, 5, e993-e993 (2014-01-18)
Delayed neuronal cell death largely contributes to the progressive infarct development and associated functional impairments after cerebral ischemia or brain trauma. Previous studies exposed a key role for the interaction of the mitochondrial protein apoptosis-inducing factor (AIF) and cytosolic cyclophilin
Hiroya Fujioka et al.
Oncology letters, 13(1), 289-295 (2017-01-27)
Paclitaxel is widely used to treat various cancers; however, resistance to this drug is a major obstacle to breast cancer chemotherapy. To identify the proteins involved in paclitaxel resistance, the present study compared the proteomes of MCF-7 human breast cancer
Hiroaki Takeuchi et al.
Retrovirology, 9, 3-3 (2012-01-10)
An understanding of host cell factors that affect viral replication contributes to elucidation of the mechanism for determination of viral tropism. Cyclophilin A (CypA), a peptidyl-prolyl cis-trans isomerase (PPIase), is a host factor essential for efficient replication of human immunodeficiency
Zhi-Ying Qi et al.
Journal of ovarian research, 12(1), 118-118 (2019-12-01)
Ovarian cancer (OC) is a type of gynaecological malignancy with high mortality in females. Serous ovarian cancer (SOC) is a distinct subtype of OC with poor early diagnosis. Given the limitations of traditional therapies, such as chemotherapy, targeted treatment is
Huan Zhang et al.
PloS one, 9(3), e92824-e92824 (2014-03-26)
Hypoxia-inducible factor-1α (HIF-1α) is a highly important transcription factor involved in cell metabolism. HIF-1α promotes glycolysis and inhibits of mitochondrial respiration in pancreatic ductal adenocarcinoma (PDAC). In response to tumor hypoxia, cyclophilin A (CypA) is over-expressed in various cancer types

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica