Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU159431

Sigma-Aldrich

MISSION® esiRNA

targeting human USP9X

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

TTCCTGCATCCAATGTTTACCTACAGTATATGAGAAATGGAGAGCTTCCAGCTGAACAGGCTATTCCGGTCTGTGGTTCACCACCTACAATTAATGCTGGTTTTGAATTACTTGTAGCATTAGCTGTTGGCTGTGTGAGGAATCTCAAACAAATAGTAGATTCTTTGACTGAAATGTATTACATTGGCACAGCAATAACTACTTGTGAAGCACTTACTGAGTGGGAATATCTGCCACCTGTTGGACCCCGCCCACCCAAAGGATTCGTGGGGCTGAAAAATGCCGGTGCTACTTGTTACATGAATTCTGTGATTCAGCAACTCTACATGATTCCTTCCATTAGGAACGGTATTCTTGCCATTGAAGGCACAGGTAGTGATGTAGATGATGATATGTCTGGGGATGAGAAGCA

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Hui Peng et al.
The Journal of reproduction and development, 64(2), 173-177 (2018-02-13)
Fas-associated protein factor 1 (FAF1) is a Fas-associated protein that functions in multiple cellular processes. Previous research showed that mutations in Faf1 led to the lethality of cleavage stage embryos in a mouse model. The aim of the present study
Hua He et al.
ACS nano, 10(2), 1859-1870 (2016-01-27)
Treatment of inflammatory diseases represents one of the biggest clinical challenges. RNA interference (RNAi) against TNF-α provides a promising modality toward anti-inflammation therapy, but its therapeutic potential is greatly hampered by the by the lack of efficient siRNA delivery vehicles
Yu Xia et al.
International journal of nanomedicine, 13, 143-159 (2018-01-11)
Human homeobox protein (Nanog) is highly expressed in most cancer cells and has gradually emerged as an excellent target in cancer therapy, owing to its regulation of cancer cell proliferation, metastasis and apoptosis. In this study, we prepared tumor-targeting functionalized
Gang Chen et al.
ACS nano, 12(7), 6620-6636 (2018-07-10)
Metastatic breast cancer is a major cause of cancer-related female mortality worldwide. The signal transducer and activator of transcription 3 (STAT3) and the chemokine receptor CXCR4 are involved in the metastatic spread of breast cancer. The goal of this study
Jesse L Cox et al.
Cancer biology & therapy, 15(8), 1042-1052 (2014-05-21)
Pancreatic ductal adenocarcinoma (PDAC) is one of the most aggressive and deadly malignancies. Recently, the deubiquitinating protease USP9X has been shown to behave as an oncogene in a number of neoplasms, including those of breast, brain, colon, esophagus and lung

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica