Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU155151

Sigma-Aldrich

MISSION® esiRNA

targeting human EP300

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

ATACCGAACCAAAGCCCTCTTTGCCTTTGAAGAAATTGATGGTGTTGACCTGTGCTTCTTTGGCATGCATGTTCAAGAGTATGGCTCTGACTGCCCTCCACCCAACCAGAGGAGAGTATACATATCTTACCTCGATAGTGTTCATTTCTTCCGTCCTAAATGCTTGAGGACTGCAGTCTATCATGAAATCCTAATTGGATATTTAGAATATGTCAAGAAATTAGGTTACACAACAGGGCATATTTGGGCATGTCCACCAAGTGAGGGAGATGATTATATCTTCCATTGCCATCCTCCTGACCAGAAGATACCCAAGCCCAAGCGACTGCAGGAATGGTACAAAAAAATGCTTGACAAGGCTGTATCAGAGCGTATTGTCCATGACTACAAGGATATTTTTAAACAAGCTACTGAAGATAGATTAACAAGTGCAAAGGAATTGCCTTATTTCGAGGGTGATTTCTGGCCCAATGTTCTG

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Jia Tao et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 106, 1727-1733 (2018-08-19)
Pulmonary fibrosis is strongly correlated with inflammation factors, cytokine, and collagen secretion, whereby discoidin domain receptor 1 (DDR1) signaling plays an important role. EP300 is defined as an acetyltransferase that can acetylate histone and has been broadly studied in several
Mizuo Ando et al.
Nature communications, 10(1), 2188-2188 (2019-05-18)
Although promoter-associated CpG islands have been established as targets of DNA methylation changes in cancer, previous studies suggest that epigenetic dysregulation outside the promoter region may be more closely associated with transcriptional changes. Here we examine DNA methylation, chromatin marks
Alexander Ring et al.
BMC cancer, 20(1), 1076-1076 (2020-11-11)
Triple negative breast cancer (TNBC) is an aggressive breast cancer subtype with basal features, lacking the expression of receptors targeted successfully in other breast cancer subtypes. Treatment response to adjuvant and neoadjuvant chemotherapy is often short-lived and metastatic spread occurs
Karen Dendoncker et al.
Proceedings of the National Academy of Sciences of the United States of America, 116(26), 12942-12951 (2019-06-12)
Glucocorticoid resistance (GCR) is defined as an unresponsiveness to the therapeutic effects, including the antiinflammatory ones of glucocorticoids (GCs) and their receptor, the glucocorticoid receptor (GR). It is a problem in the management of inflammatory diseases and can be congenital
Alejandro Ropolo et al.
Frontiers in endocrinology, 11, 411-411 (2020-07-14)
Autophagy is an evolutionarily preserved degradation process of cytoplasmic cellular constituents, which participates in cell response to disease. We previously characterized VMP1 (Vacuole Membrane Protein 1) as an essential autophagy related protein that mediates autophagy in pancreatic diseases. We also

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica