Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EHU137641

Sigma-Aldrich

MISSION® esiRNA

targeting human ARF6

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GAGAGGCTTCGTTTCGGTTTCGCGGCGGCGGCGGCGTTGTTGGCTGAGGGGACCCGGGACACCTGAATGCCCCCGGCCCCGGCTCCTCCGACGCGATGGGGAAGGTGCTATCCAAAATCTTCGGGAACAAGGAAATGCGGATCCTCATGTTGGGCCTGGACGCGGCCGGCAAGACAACAATCCTGTACAAGTTGAAGCTGGGCCAGTCGGTGACCACCATTCCCACTGTGGGTTTCAACGTGGAGACGGTGACTTACAAAAATGTCAAGTTCAACGTATGGGATGTGGGCGGCCAGGACAAGATCCGGCCGCTCTGGCGGCATTACTACACTGGGACCCAAGGTCTCATCTTCGTAGTGGACTGCGCCGACCGCGACCGCATCGATGAGGCTCGCCAGGAGCTGCACCGCATTATCAATGACCGGGAGATGAG

Ensembl | Número de adesão de ser humano

ENSG00000165527

nº de adesão NCBI

NM_001663

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... ARF6(382) , ARF6(382)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Yujie Zhang et al.
Oncotarget, 6(9), 7244-7261 (2015-03-18)
Wnt5a, a ligand for activating the non-canonical Wnt signaling pathway, is commonly associated with Epithelial-to-mesenchymal transition (EMT) in cancer cell metastasis. Here, we show that downregulation of Wnt5a mRNA and protein by EGF is necessary for EGF-induced EMT in gastric
Yueh-Chien Lin et al.
Scientific reports, 7(1), 11431-11431 (2017-09-14)
The small GTPase Arf6 plays pivotal roles in a wide variety of cellular events such as endocytosis, exocytosis, and actin cytoskeleton reorganization. However, the physiological functions of Arf6 at the whole animal level have not yet been thoroughly understood. Here
Vahitha B Abdul-Salam et al.
Circulation research, 124(1), 52-65 (2018-12-26)
Increased expression of CLIC4 (chloride intracellular channel 4) is a feature of endothelial dysfunction in pulmonary arterial hypertension, but its role in disease pathology is not fully understood. To identify CLIC4 effectors and evaluate strategies targeting CLIC4 signaling in pulmonary
Mohamed Bourmoum et al.
Journal of cell science, 131(11) (2018-05-05)
Sister chromatid cohesion, facilitated by the cohesin protein complex, is crucial for the establishment of stable bipolar attachments of chromosomes to the spindle microtubules and their faithful segregation. Here, we demonstrate that the GTPase ARF6 prevents the premature loss of
Jamie S Lin et al.
PloS one, 12(9), e0184575-e0184575 (2017-09-08)
ADP-ribosylation factor 6 (ARF6) is a small GTPase necessary for regulating cellular structure, motility, and vesicle trafficking. In several cellular systems, ARF6 was shown to regulate actin dynamics in coordination with Rac1, a Rho small GTPase. We examined the function
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica