Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU122601

Sigma-Aldrich

MISSION® esiRNA

targeting human TP63

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

AACAGCCATGCCCAGTATGTAGAAGATCCCATCACAGGAAGACAGAGTGTGCTGGTACCTTATGAGCCACCCCAGGTTGGCACTGAATTCACGACAGTCTTGTACAATTTCATGTGTAACAGCAGTTGTGTTGGAGGGATGAACCGCCGTCCAATTTTAATCATTGTTACTCTGGAAACCAGAGATGGGCAAGTCCTGGGCCGACGCTGCTTTGAGGCCCGGATCTGTGCTTGCCCAGGAAGAGACAGGAAGGCGGATGAAGATAGCATCAGAAAGCAGCAAGTTTCGGACAGTACAAAGAACGGTGATGGTACGAAGCGCCCGTTTCGTCAGAACACACATGGTATCCAGATGACATCCATCAAGAAACGAAGATCCCCAGATGATGAACTGTTATACTTACCAGTGAGGGGCCGTGAGACTTATGAAATGCTGTTGAAGATCAAAGAGTCCCTGGAACTCATGCAGTACCTTCCTCAGCACACAATTG

Ensembl | Número de adesão de ser humano

ENSG00000073282

nº de adesão NCBI

NM_001114978

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... TP63(8626) , TP63(8626)

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Swarnabh Bhattacharya et al.
Stem cells (Dayton, Ohio), 37(3), 417-429 (2018-12-15)
Mutations in key transcription factors SOX2 and P63 were linked with developmental defects and postnatal abnormalities such as corneal opacification, neovascularization, and blindness. The latter phenotypes suggest that SOX2 and P63 may be involved in corneal epithelial regeneration. Although P63
Shuai Ye et al.
International journal of oncology, 44(6), 2153-2159 (2014-04-11)
p63 is a member of the p53 protein family and plays a crucial role in epithelial development. p63 is expressed in many types of tumors including esophageal cancer; however, its function in cancer is controversial and its role in esophageal
Hulda R Jonsdottir et al.
Laboratory investigation; a journal of technical methods and pathology, 95(12), 1418-1428 (2015-09-22)
Idiopathic pulmonary fibrosis (IPF) is a progressive interstitial lung disease with high morbidity and mortality. The cellular source of the fibrotic process is currently under debate with one suggested mechanism being epithelial-to-mesenchymal transition (EMT) in the alveolar region. In this

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica