Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU145621

Sigma-Aldrich

MISSION® esiRNA

targeting human CLDN7

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CAAAGTGAAGAAGGCCCGTATAGCCATGGGTGGAGGCATAATTTTCATCGTGGCAGGTCTTGCCGCCTTGGTAGCTTGCTCCTGGTATGGCCATCAGATTGTCACAGACTTTTATAACCCTTTGATCCCTACCAACATTAAGTATGAGTTTGGCCCTGCCATCTTTATTGGCTGGGCAGGGTCTGCCCTAGTCATCCTGGGAGGTGCACTGCTCTCCTGTTCCTGTCCTGGGAATGAGAGCAAGGCTGGGTACCGTGTACCCCGCTCTTACCCTAAGTCCAACTCTTCCAAGGAGTATGTGTGACCTGGGATCTCCTTGCCCCAGCCTGACAGGCTATGGGAGTGTCTAGATGCCTGAAAGGGCCTGGGGCTGAGCTCAGCCTGTGGGCAGGGTGCCGGACAAAGGCCTCCTGGTCACTCT

Ensembl | Número de adesão de ser humano

ENSG00000181885

nº de adesão NCBI

NM_001307

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... CLDN7(1366) , CLDN7(1366)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Di Gao et al.
Theriogenology, 158, 346-357 (2020-10-11)
Trophectoderm (TE) barrier function is an essential prerequisite for blastocyst development. CLAUDIN7 (CLDN7), a member of CLAUDINS family, is involved in regulating intercellular exchange and cell polarity in epithelium cells. However, the role of CLDN7 in porcine early embryo development
Thanh Q Dang et al.
The Journal of endocrinology, 234(2), 101-114 (2017-07-15)
Altered permeability of the endothelial barrier in a variety of tissues has implications both in disease pathogenesis and treatment. Glucocorticoids are potent mediators of endothelial permeability, and this forms the basis for their heavily prescribed use as medications to treat
Norimitsu Okui et al.
Pancreatology : official journal of the International Association of Pancreatology (IAP) ... [et al.], 19(1), 88-96 (2018-11-13)
Pancreatic cancer consists of various subpopulations of cells, some of which have aggressive proliferative properties. The molecules responsible for the aggressive proliferation of pancreatic cancer may become molecular targets for the therapies against pancreatic cancer. From a human pancreatic cancer
Fabian Horné et al.
Reproductive sciences (Thousand Oaks, Calif.), 26(9), 1181-1192 (2018-12-06)
Claudins are the major components of tight junctions and are often deregulated in human cancer, permitting escape of cancer cells along with the acquisition of invasive properties. Similarly, endometrial cells also show invasive capabilities; however, the role of tight junctions

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica