Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU114901

Sigma-Aldrich

MISSION® esiRNA

targeting human ATF4

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CCAACAACAGCAAGGAGGATGCCTTCTCCGGGACAGATTGGATGTTGGAGAAAATGGATTTGAAGGAGTTCGACTTGGATGCCCTGTTGGGTATAGATGACCTGGAAACCATGCCAGATGACCTTCTGACCACGTTGGATGACACTTGTGATCTCTTTGCCCCCCTAGTCCAGGAGACTAATAAGCAGCCCCCCCAGACGGTGAACCCAATTGGCCATCTCCCAGAAAGTTTAACAAAACCCGACCAGGTTGCCCCCTTCACCTTCTTACAACCTCTTCCCCTTTCCCCAGGGGTCCTGTCCTCCACTCCAGATCATTCCTTTAGTTTAGAGCTGGGCAGTGAAGTGGATATCACTGAAGGAGATAGGAAGCCAGACTACACTGCTTACGTTGCCATGATCCCT

Ensembl | Número de adesão de ser humano

ENSG00000128272

nº de adesão NCBI

NM_001675

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... ATF4(468) , ATF4(468)

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
CEV
IOU
EJU
KIU
VHU

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Ritesh K Srivastava et al.
Toxicology and applied pharmacology, 308, 46-58 (2016-07-28)
Chronic arsenic exposure to humans is considered immunosuppressive with augmented susceptibility to several infectious diseases. The exact molecular mechanisms, however, remain unknown. Earlier, we showed the involvement of unfolded protein response (UPR) signaling in arsenic-mediated impairment of macrophage functions. Here
Zhen Ren et al.
Toxicological sciences : an official journal of the Society of Toxicology, 154(2), 368-380 (2016-09-11)
Nefazodone, an antagonist for the 5-hydroxytryptanine receptor, has been used for the treatment of depression. Acute liver injury has been documented to be associated with the use of nefazodone; however, the mechanisms of nefazodone-induced liver toxicity are not well defined.
Wolfgang Fischer et al.
Redox biology, 21, 101089-101089 (2018-12-31)
Alzheimer's disease (AD) is the most frequent age-associated dementia with no treatments that can prevent or slow its progression. Since age is by far the major risk factor for AD, there is a strong rationale for an alternative approach to
Yoko Tabe et al.
Scientific reports, 8(1), 16837-16837 (2018-11-18)
Adipocytes are the prevalent stromal cell type in adult bone marrow (BM), and leukemia cells continuously adapt to deficiency of nutrients acquiring chemoresistant profiles in the BM microenvironment. We have previously shown that fatty acid metabolism is a key energy
Song Gao et al.
Journal of experimental & clinical cancer research : CR, 36(1), 179-179 (2017-12-09)
A growing amount of evidence has indicated that PSAT1 is an oncogene that plays an important role in cancer progression and metastasis. In this study, we explored the expression and function of PSAT1 in estrogen receptor (ER)-negative breast cancer. The
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica