Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU111091

Sigma-Aldrich

MISSION® esiRNA

targeting human XIAP

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CCATGGCAGATTATGAAGCACGGATCTTTACTTTTGGGACATGGATATACTCAGTTAACAAGGAGCAGCTTGCAAGAGCTGGATTTTATGCTTTAGGTGAAGGTGATAAAGTAAAGTGCTTTCACTGTGGAGGAGGGCTAACTGATTGGAAGCCCAGTGAAGACCCTTGGGAACAACATGCTAAATGGTATCCAGGGTGCAAATATCTGTTAGAACAGAAGGGACAAGAATATATAAACAATATTCATTTAACTCATTCACTTGAGGAGTGTCTGGTAAGAACTACTGAGAAAACACCATCACTAACTAGAAGAATTGATGATACCATCTTCCAAAATCCTATGGTACAAGAAGCTATACGAATGGGGTTCAGTTTCAAGGACATTAAGAAAATAATGGAGGAAAAAATTCAGATATCTGGGAGCAACTATAAATCACTTGAGGTTCTGGTTGCA

Ensembl | Número de adesão de ser humano

ENSG00000101966

nº de adesão NCBI

NM_001167

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... XIAP(331) , XIAP(331)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Ke Ren et al.
Pathology oncology research : POR, 25(1), 341-348 (2017-11-11)
To find the exact downstream effector of Pim-2 pathway in prostate cancer cells, and to determine the means by which it affects prostate cancer. XIAP, Pim-2 and p-eIF4B expressions were detected in PCA and BPH tissues. Then the Pim-2 and
Ying Hou et al.
Journal of cell science, 130(2), 502-511 (2016-12-09)
Regulation of cell death is crucial for the response of cancer cells to drug treatments that cause arrest in mitosis, and is likely to be important for protection against chromosome instability in normal cells. Prolonged mitotic arrest can result in
Morikazu Miyamoto et al.
Anticancer research, 38(1), 301-306 (2017-12-27)
To investigate whether XIAP down-regulation and autophagy inhibition sensitize ovarian clear cell cancer cells to cisplatin. The ovarian clear cancer cell line KK was used for in vitro analysis. Hydroxychloroquine (HCQ) and phenoxodiol (PXD) or embelin were used as autophagy
Xiaodi Li et al.
International journal of oncology, 51(1), 327-335 (2017-06-01)
MicroRNAs play a crucial role in gene expression regulation in various types of cancers. Previous studies show the expression level of miR‑146a‑5p is downregulated in epithelial ovarian cancer. Further investigations suggest this downregulation is responsible for apoptosis resistance in ovarian
Rachel Coyle et al.
International journal of oncology, 55(1), 191-202 (2019-05-23)
Malignant rhabdoid tumour (MRT) is a rare, aggressive paediatric neoplasm, primarily diagnosed in those below the age of three. MRTs most commonly arise in the central nervous system and kidneys. A poor prognosis accompanies the MRT diagnosis, with a reported
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica