Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU109061

Sigma-Aldrich

MISSION® esiRNA

targeting human RNF2

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CACTAAGGCCAGACCCAAACTTTGATGCACTCATCAGCAAAATTTATCCAAGTCGTGATGAGTATGAAGCTCATCAAGAGAGAGTATTAGCCAGGATCAACAAGCACAATAATCAGCAAGCACTCAGTCACAGCATTGAGGAAGGACTGAAGATACAGGCCATGAACAGACTGCAGCGAGGCAAGAAACAACAGATTGAAAATGGTAGTGGAGCAGAAGATAATGGTGACAGTTCACACTGCAGTAATGCATCCACACATAGCAATCAGGAAGCAGGCCCTAGTAACAAACGGACCAAAACATCTGATGATTCTGGGCTAGAGCTTGATAATAACAATGCAGCAATGGCAATTGATCCAGTAATGGATGGTGCTAGTGAAATTGAATTAGTATTCAGGCCTCATCCCACACTTATGGAAAAAGATGACAGTGCACAGACGAGATACATAAAGACTTCTGGTAACGCCACTGTTG

Ensembl | Número de adesão de ser humano

ENSG00000121481

nº de adesão NCBI

NM_007212

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... RNF2(6045) , RNF2(6045)

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Feilong Wei et al.
Aging, 12(24), 26199-26220 (2020-12-22)
Ring finger protein 2 (RNF2) is an important component of polycomb repressive complex 1. RNF2 is upregulated in many kinds of tumors, and elevated RNF2 expression is associated with a poor prognosis in certain cancers. To assess the function of
Sen Zhu et al.
Nature communications, 9(1), 500-500 (2018-02-07)
BMI1, a polycomb group (PcG) protein, plays a critical role in epigenetic regulation of cell differentiation and proliferation, and cancer stem cell self-renewal. BMI1 is upregulated in multiple types of cancer, including prostate cancer. As a key component of polycomb
Brandon S Sheffield et al.
The American journal of surgical pathology, 39(7), 977-982 (2015-01-31)
A variety of immunohistochemical (IHC) stains have been proposed to mark either benign or malignant mesothelial proliferations. Loss of the p16 tumor suppressor (CDKN2A), through homozygous deletions of 9p21, is a good marker of mesotheliomas but lacks sensitivity. Recent reports

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica