Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU108481

Sigma-Aldrich

MISSION® esiRNA

targeting human RBMX

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

AGGACCACCACCAAGAAGTGGGGGTCCTCCTCCTAAGAGATCTGCACCTTCAGGACCAGTTCGCAGTAGCAGTGGAATGGGAGGAAGAGCTCCTGTATCACGTGGAAGAGATAGTTATGGAGGTCCACCTCGAAGGGAACCGCTGCCCTCTCGTAGAGATGTTTATTTGTCCCCAAGAGATGATGGGTATTCTACTAAAGACAGCTATTCAAGCAGAGATTACCCAAGTTCTCGTGATACTAGAGATTATGCACCACCACCACGAGATTATACTTACCGTGATTATGGTCATTCCAGTTCACGTGATGACTATCCATCAAGAGGATATAGCGATAGAGATGGATATGGTCGTGATCGTGACTATTCAGATCATCCAAGTGGAGGTTCCTACAGAGATTCATATGAGAGTTATGGTAACTCACGTAGTGCTCCACCTACACGAGGGCCCCCGCCATCTTATGGTGGAAGCAGTCGCTATGATG

Ensembl | Número de adesão de ser humano

ENSG00000147274

nº de adesão NCBI

NM_002139

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... RBMX(27316) , RBMX(56267)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Nian Liu et al.
Nucleic acids research, 45(10), 6051-6063 (2017-03-24)
N6-methyladenosine (m6A) is the most abundant internal modification in eukaryotic messenger RNA (mRNA), and affects almost every stage of the mRNA life cycle. The YTH-domain proteins can specifically recognize m6A modification to control mRNA maturation, translation and decay. m6A can
Justin S Becker et al.
Molecular cell, 68(6), 1023-1037 (2017-12-23)
Heterochromatin is integral to cell identity maintenance by impeding the activation of genes for alternate cell fates. Heterochromatic regions are associated with histone 3 lysine 9 trimethylation (H3K9me3) or H3K27me3, but these modifications are also found in euchromatic regions that
Katherine I Zhou et al.
Molecular cell, 76(1), 70-81 (2019-08-26)
N6-methyladenosine (m6A) modification occurs co-transcriptionally and impacts pre-mRNA processing; however, the mechanism of co-transcriptional m6A-dependent alternative splicing regulation is still poorly understood. Heterogeneous nuclear ribonucleoprotein G (hnRNPG) is an m6A reader protein that binds RNA through RRM and Arg-Gly-Gly (RGG)

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica