Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU099501

Sigma-Aldrich

MISSION® esiRNA

targeting human F11R

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CCCTTTCCTACCACTGCTGAGTGGCCTGGAACTTGTTTAAAGTGTTTATTCCCCATTTCTTTGAGGGATCAGGAAGGAATCCTGGGTATGCCATTGACTTCCCTTCTAAGTAGACAGCAAAAATGGCGGGGGTCGCAGGAATCTGCACTCAACTGCCCACCTGGCTGGCAGGGATCTTTGAATAGGTATCTTGAGCTTGGTTCTGGGCTCTTTCCTTGTGTACTGACGACCAGGGCCAGCTGTTCTAGAGCGGGAATTAGAGGCTAGAGCGGCTGAAATGGTTGTTTGGTGATGACACTGGGGTCCTTCCATCTCT

Ensembl | Número de adesão de ser humano

ENSG00000158769

nº de adesão NCBI

NM_144504

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... F11R(50848) , F11R(50848)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Jonas Franz et al.
PloS one, 11(1), e0146598-e0146598 (2016-01-06)
Endothelial barriers have a central role in inflammation as they allow or deny the passage of leukocytes from the vasculature into the tissue. To bind leukocytes, endothelial cells form adhesive clusters containing tetraspanins and ICAM-1, so-called endothelial adhesive platforms (EAPs).
Min Xie et al.
Cancer letters, 443, 67-79 (2018-12-07)
Multiple studies have revealed that long non-coding RNAs (lncRNAs) extensively participate in human cancer malignant progression. The long intergenic non-protein coding RNA 707 (LINC00707), 3087 bp in length, was recently reported to be an essential oncogene in promoting lung adenocarcinoma
Rodrigo G B Cruz et al.
Cancers, 13(4) (2021-03-07)
The success of breast cancer therapies targeting the human epidermal growth factor receptor-2 (HER2) is limited by the development of drug resistance by mechanisms including upregulation of HER3. Having reported that HER2 expression and resistance to HER2-targeted therapies can be
Nikola Sladojevic et al.
Neurobiology of disease, 67, 57-70 (2014-03-25)
Proinflammatory mediators trigger intensive postischemic inflammatory remodeling of the blood-brain barrier (BBB) including extensive brain endothelial cell surface and junctional complex changes. Junctional adhesion molecule-A (JAM-A) is a component of the brain endothelial junctional complex with dual roles: paracellular route
Hüseyin Tuncay et al.
Nature communications, 6, 8128-8128 (2015-08-27)
Planar spindle orientation in polarized epithelial cells depends on the precise localization of the dynein-dynactin motor protein complex at the lateral cortex. The contribution of cell adhesion molecules to the cortical localization of the dynein-dynactin complex is poorly understood. Here

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica