Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU074041

Sigma-Aldrich

MISSION® esiRNA

targeting human PRKAA1

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TGCTCAGAAGAGGAAGTTCTCAGCTGTCTTTACAACAGAAATCACCAGGATCCTTTGGCAGTTGCCTACCATCTCATAATAGATAACAGGAGAATAATGAATGAAGCCAAAGATTTCTATTTGGCGACAAGCCCACCTGATTCTTTTCTTGATGATCATCACCTGACTCGGCCCCATCCTGAAAGAGTACCATTCTTGGTTGCTGAAACACCAAGGGCACGCCATACCCTTGATGAATTAAATCCACAGAAATCCAAACACCAAGGTGTAAGGAAAGCAAAATGGCATTTAGGAATTAGAAGTCAAAGTCGACCAAATGATATTATGGCAGAAGTATGTAGAGCAATCAAACAATTGGATTATGAATGGAAGGTTGTAAACCCATATTATTTGCGTGTACGAAGGAAGA

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Cuiping Dai et al.
Oncotarget, 8(56), 95810-95823 (2017-12-10)
LB-100 is a novel PP2A inhibitor. Its activity in human colorectal cancer (CRC) cells was tested. The
Xue Han et al.
Oncogene, 38(38), 6537-6549 (2019-07-31)
Endometrial cancer (EC) is one of the most common gynecologic malignancies. However, the molecular mechanisms underlying the development and progression of EC remain unclear. Here, we demonstrated that the protein proviral insertion in murine lymphomas 2 (PIM2) was necessary for
Takuma Hashimoto et al.
Biochemical and biophysical research communications, 505(1), 13-19 (2018-09-19)
Solid tumors often contain hypoxic regions because an abnormal and inefficient tumor vasculature is unable to supply sufficient oxygen. Tissue hypoxia is generally defined as a low oxygen concentration of less than 2%. It is well known that tumor cells
Ying-Nan Wang et al.
Oncogene, 39(3), 637-650 (2019-09-19)
Patients with stage II or III colorectal cancer (CRC) exhibit various clinical outcomes after radical treatments. The 5-year survival rate was between 50 and 87%. However, the underlying mechanisms of the variation remain unclear. Here we show that AMPKα1 is
Javier Sáenz et al.
The Journal of nutritional biochemistry, 54, 48-56 (2017-12-16)
Liver X receptor alpha (LXRα) is a nuclear receptor involved in cholesterol homeostasis. Curcumin, a traditional Chinese derivative from the rhizomes of Curcuma longa and a well-known AMP-activated protein kinase (AMPK) activator, possess hypocholesterolemic activity, however, the possible link between

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica