Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU067871

Sigma-Aldrich

MISSION® esiRNA

targeting human AMBRA1

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TTCGGTGAGTTTGCTGTCTGTGCTGAGACAGCAGGAAGGTGGCTCTCAGGCATCTGTGTACACTTCAGCCACAGAAGGGAGGGGTTTTCCGGCATCAGGGTTGGCAACTGAGTCAGATGGAGGGAATGGCTCCAGCCAAAACAACTCGGGCAGCATTCGCCATGAGCTTCAGTGTGACCTGAGACGCTTCTTTCTGGAGTATGACCGGCTTCAGGAGCTGGATCAGAGCCTGAGTGGGGAAGCTCCCCAGACCCAACAGGCCCAGGAAATGCTCAACAATAACATTGAATCTGAGAGGCCAGGCCCTTCCCACCAGCCCACCCCACACAGCAGTGAGAACAACTCCAACCTGTCCCGTGGCCACCTGAATCGCTGTCGTGCTTGCCACAATCTCCTGACCTTCAACAACGATACCCTGCGCTGGGAAAGAACCACACCTAACTACTCCTCTGGCGAGGCTA

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Wei-Liang Sun et al.
Cancer science, 109(10), 3129-3138 (2018-07-22)
The sensitivity of breast cancer cells to epirubicin (EPI) is closely related to the efficacy of the drug and the prognosis of patients. A growing body of research has suggested that autophagy is involved in the treatment of a variety
Yasuo Miki et al.
Brain pathology (Zurich, Switzerland), 28(1), 28-42 (2016-11-23)
The accumulation of abnormal α-synuclein is the major histopathological feature of Lewy body disease and multiple system atrophy (MSA), which are referred to as synucleinopathies. Cytoplasmic degradation systems, such as the autophagy-lysosome and proteasome pathways, are involved in their pathogenesis.

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica