Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU063551

Sigma-Aldrich

MISSION® esiRNA

targeting human CUL3

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

AGTGATGCACTGCCTTGACAAATCAACGGAAGAACCAATTGTAAAGGTGGTTGAAAGGGAACTCATTTCCAAGCACATGAAGACTATAGTAGAAATGGAGAATTCTGGGCTAGTACATATGTTGAAAAATGGAAAGACAGAAGACCTTGGTTGCATGTACAAGTTATTTAGTCGTGTGCCAAATGGTTTGAAAACAATGTGTGAGTGTATGAGTTCCTATTTGAGGGAGCAAGGTAAAGCTCTTGTTTCTGAAGAAGGAGAAGGAAAGAATCCTGTTGACTATATCCAGGGCTTATTGGATCTGAAGAGTAGGTTCGATCGCTTCCTCCTGGAATCATTCAACAATGACCGTCTCTTTAAACAAACTATTGCGGGTGACTTTGAGTATTTTCTCAACCTCAACTCCAGGTCTCCTG

Ensembl | Número de adesão de ser humano

ENSG00000036257

nº de adesão NCBI

NM_003590

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... CUL3(8452) , CUL3(8452)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
ZYU
MYU
KXU
OWU
QCS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Tomohisa Sakaue et al.
Cancer science, 108(2), 208-215 (2016-12-18)
Vascular endothelial (VE)-cadherin, a major endothelial adhesion molecule, regulates vascular permeability, and increased vascular permeability has been observed in several cancers. The aim of this study was to elucidate the role of the NEDD8-Cullin E3 ligase, in maintaining barrier permeability.
Tomohisa Sakaue et al.
Scientific reports, 7, 42845-42845 (2017-02-22)
Vascular endothelial cell growth factor receptor 2 (VEGFR2) is an essential receptor for the homeostasis of endothelial cells. In this study, we showed that NEDD8-conjugated Cullin3 (CUL3)-based ubiquitin E3 (UbE3) ligase plays a crucial role in VEGFR2 mRNA expression. Human
Alexandros P Drainas et al.
Cell reports, 31(1), 107465-107465 (2020-04-09)
TP53 deficiency is the most common alteration in cancer; however, this alone is typically insufficient to drive tumorigenesis. To identify genes promoting tumorigenesis in combination with TP53 deficiency, we perform genome-wide CRISPR-Cas9 knockout screens coupled with proliferation and transformation assays
Antonio Pisano et al.
The Journal of biological chemistry, 290(22), 13958-13971 (2015-04-18)
The human inhibitor of Bruton's tyrosine kinase isoform α (IBtkα) is a BTB protein encoded by the IBTK gene, which maps to chromosomal locus 6q14.1, a mutational hot spot in lymphoproliferative disorders. Here, we demonstrate that IBtkα forms a CRL3(IBTK)
Qian Zhang et al.
Reproduction (Cambridge, England), 150(2), 139-149 (2015-05-30)
Cullin 3 (CUL3), a scaffold protein, assembles a large number of ubiquitin ligase complexes, similar to Skp1-Cullin 1-F-box protein complex. Several genetic models have shown that CUL3 is crucial for early embryonic development. Nevertheless, the role of CUL3 in human

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica