Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU055111

Sigma-Aldrich

MISSION® esiRNA

targeting human NOTCH3

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TCTCAGACTGGTCCGAATCCACGCCTAGCCCAGCCACTGCCACTGGGGCCATGGCCACCACCACTGGGGCACTGCCTGCCCAGCCACTTCCCTTGTCTGTTCCCAGCTCCCTTGCTCAGGCCCAGACCCAGCTGGGGCCCCAGCCGGAAGTTACCCCCAAGAGGCAAGTGTTGGCCTGAGACGCTCGTCAGTTCTTAGATCTTGGGGGCCTAAAGAGACCCCCGTCCTGCCTCCTTTCTTTCTCTGTCTCTTCCTTCCTTTTAGTCTTTTTCATCCTCTTCTCTTTCCACCAACCCTCCTGCATCCTTGCCTTGCAGCGTGACCGAGATAGGTCATCAGCCCAGGGCTTCAGTCTTCCTTTATTTATAATGGGTGGGGGCTACCACCCACCCTCTCAGTC

Ensembl | Número de adesão de ser humano

ENSG00000074181

nº de adesão NCBI

NM_000435

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... NOTCH3(4854) , NOTCH3(4854)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
HYU
QCS
YRT
BVS
JBS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Yumi Yamamoto et al.
Molecular brain, 13(1), 38-38 (2020-03-20)
Cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL) is one of the most common forms of hereditary cerebral small vessel diseases and is caused by mutations in NOTCH3. Our group has previously reported incorporation of NOTCH3 extracellular domain
Yash R Somnay et al.
Cancer, 123(5), 769-782 (2016-11-20)
Thyroid tumorigenesis is characterized by a progressive loss of differentiation exhibited by a range of disease variants. The Notch receptor family (1-4) regulates developmental progression in both normal and cancerous tissues. This study sought to characterize the third Notch isoform
Keito Okazaki et al.
Nature communications, 11(1), 5911-5911 (2020-11-22)
Transcriptional dysregulation, which can be caused by genetic and epigenetic alterations, is a fundamental feature of many cancers. A key cytoprotective transcriptional activator, NRF2, is often aberrantly activated in non-small cell lung cancers (NSCLCs) and supports both aggressive tumorigenesis and
Wei Hu et al.
Cancer research, 74(12), 3282-3293 (2014-04-20)
The Notch pathway plays an important role in the growth of high-grade serous ovarian (HGS-OvCa) and other cancers, but its clinical and biologic mechanisms are not well understood. Here, we found that the Notch pathway alterations are prevalent and significantly

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica