Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU053891

Sigma-Aldrich

MISSION® esiRNA

targeting human TET1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

AAAAGACCTCCAAGACCCAAACTTACAGGGAGAGCCACCAAAACTTAATCACTGTCCATCTTTGGAAAAACAAAGTTCATGCAACACGGTGGTTTTCAATGGGCAAACTACTACCCTTTCCAACTCACATATCAACTCAGCTACTAACCAAGCATCCACAAAGTCACATGAATATTCAAAAGTCACAAATTCATTATCTCTTTTTATACCAAAATCAAATTCATCCAAGATTGACACCAATAAAAGTATTGCTCAAGGGATAATTACTCTTGACAATTGTTCCAATGATTTGCATCAGTTGCCACCAAGAAATAATGAAGTGGAGTATTGCAACCAGTTACTGGACAGCAGCAAAAAATTGGACTCAGATGATCTATCATGTCAGGATGCAACCCATACC

Ensembl | Número de adesão de ser humano

ENSG00000138336

nº de adesão NCBI

NM_030625

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... TET1(80312) , TET1(80312)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
NAV
XQU
WSS
ZQS
BQS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Ryan J Marina et al.
The EMBO journal, 35(3), 335-355 (2015-12-30)
Intragenic 5-methylcytosine and CTCF mediate opposing effects on pre-mRNA splicing: CTCF promotes inclusion of weak upstream exons through RNA polymerase II pausing, whereas 5-methylcytosine evicts CTCF, leading to exon exclusion. However, the mechanisms governing dynamic DNA methylation at CTCF-binding sites
Piotr T Filipczak et al.
Cancer research, 79(8), 1758-1768 (2019-01-10)
The role of transcriptional regulator ten-eleven translocation methylcytosine dioxygenease 1 (TET1) has not been well characterized in lung cancer. Here we show that TET1 is overexpressed in adenocarcinoma and squamous cell carcinomas. TET1 knockdown reduced cell growth in vitro and
Li Gao et al.
International journal of biological sciences, 16(8), 1324-1334 (2020-03-27)
Myostatin (MSTN) is mostly expressed in skeletal muscle and plays crucial roles in the negative regulation of muscle mass development. The methylation and demethylation of myogenesis-specific genes are major regulatory factors in muscle satellite cell differentiation. The present study was
Bo Hu et al.
Journal of cellular biochemistry, 120(4), 6330-6338 (2018-10-27)
Long noncoding RNAs (lncRNAs) have been reported to take part in intracellular RNA regulatory networks and play important roles in a lot of pathological processes. Currently, lncRNA X-inactive specific transcript (XIST) has been proved to regulate cell migration, proliferation, and
Pankaj Prasad et al.
Stem cells (Dayton, Ohio), 35(6), 1468-1478 (2017-04-05)
Activation of pluripotency regulatory circuit is an important event in solid tumor progression and the hypoxic microenvironment is known to enhance the stemness feature of some cells. The distinct population of cancer stem cells (CSCs)/tumor initiating cells exist in a
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica