Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU050101

Sigma-Aldrich

MISSION® esiRNA

targeting human PARP1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CACTCATGCAACCACACACAATGCGTATGACTTGGAAGTCATCGATATCTTTAAGATAGAGCGTGAAGGCGAATGCCAGCGTTACAAGCCCTTTAAGCAGCTTCATAACCGAAGATTGCTGTGGCACGGGTCCAGGACCACCAACTTTGCTGGGATCCTGTCCCAGGGTCTTCGGATAGCCCCGCCTGAAGCGCCCGTGACAGGCTACATGTTTGGTAAAGGGATCTATTTCGCTGACATGGTCTCCAAGAGTGCCAACTACTGCCATACGTCTCAGGGAGACCCAATAGGCTTAATCCTGTTGGGAGAAGTTGCCCTTGGAAACATGTATGAACTGAAGCACGCTTCACATATCAGCAAGTTACCCAAGGGCAAGCACAGTGTCAAAGGTTTGGGCAAAAC

Ensembl | Número de adesão de ser humano

ENSG00000143799

nº de adesão NCBI

NM_001618

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... PARP1(142) , PARP1(142)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Monica E Wielgos et al.
Molecular cancer therapeutics, 17(5), 921-930 (2018-03-30)
HER2-targeted therapies, such as trastuzumab, have increased the survival rates of HER2+ breast cancer patients. However, despite these therapies, many tumors eventually develop resistance to these therapies. Our lab previously reported an unexpected sensitivity of HER2+ breast cancer cells to
Hogyoung Kim et al.
Journal of translational medicine, 13, 233-233 (2015-07-18)
We and others have extensively investigated the role of PARP-1 in cell growth and demise in response to pathophysiological cues. Most of the clinical trials on PARP inhibitors are targeting primarily estrogen receptor (ER) negative cancers with BRCA-deficiency. It is
Zhuoyu Gu et al.
Journal of hematology & oncology, 11(1), 115-115 (2018-09-16)
Recently, many potential prognostic biomarkers for gastric cancer (GC) have been identified, but the prognosis of advanced GC patients remains poor. Chloride channels are promising cancer biomarkers, and their family member chloride channel-3 (CLC-3) is involved in multiple biological behaviors.
Manish Mishra et al.
Biochimica et biophysica acta, 1863(7), 1761-1769 (2017-05-10)
In diabetes, matrix metalloproteinase-9 (MMP-9) is activated, which damages mitochondria, resulting in accelerated capillary cell apoptosis. Regulation of MMP-9 is controlled by multiple transcription factors including nuclear factor-kB (NF-kB) and activator protein-1 (AP-1). Binding of these transcription factors, however, can
Qianghua Xia et al.
Diabetologia, 59(11), 2360-2368 (2016-08-20)
One of the most strongly associated type 2 diabetes loci reported to date resides within the TCF7L2 gene. Previous studies point to the T allele of rs7903146 in intron 3 as the causal variant at this locus. We aimed to
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica