Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU035581

Sigma-Aldrich

MISSION® esiRNA

targeting human HDAC3

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GAGCTGACTCTCTGGGCTGTGATCGATTGGGCTGCTTTAACCTCAGCATCCGAGGGCATGGGGAATGCGTTGAATATGTCAAGAGCTTCAATATCCCTCTACTCGTGCTGGGTGGTGGTGGTTATACTGTCCGAAATGTTGCCCGCTGCTGGACATATGAGACATCGCTGCTGGTAGAAGAGGCCATTAGTGAGGAGCTTCCCTATAGTGAATACTTCGAGTACTTTGCCCCAGACTTCACACTTCATCCAGATGTCAGCACCCGCATCGAGAATCAGAACTCACGCCAGTATCTGGACCAGATCCGCCAGACAATCTTTGAAAACCTGAAGATGCTGAACCATGCACCTAGTGTCCAGATTCATGACGTGCCTGCAGACCTCCTGACCTATGACAGGACTGATGAGGCTG

Ensembl | Número de adesão de ser humano

ENSG00000171720

nº de adesão NCBI

NM_003883

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... HDAC3(8841) , HDAC3(8841)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Yuyao Yin et al.
Cell death & disease, 8(6), e2856-e2856 (2017-06-02)
Histone deacetylase 3 (HDAC3) has an oncogenic role in apoptosis and contributes to the proliferation of cancer cells. MI192 is a novel HDAC3-specific inhibitor that displays antitumor activity in many cancer cell lines. However, the role of HDAC3 and the
Jingzhu Zhang et al.
Frontiers in molecular neuroscience, 10, 395-395 (2017-12-15)
The impairment of amyloid-β (Aβ) clearance in the brain plays a causative role in Alzheimer's disease (AD). Polarity distribution of aquaporin-4 (AQP4) is important to remove Aβ from brain. AQP4 polarity can be influenced by the ratio of two AQP4
A Krell et al.
Neuropathology and applied neurobiology, 45(5), 441-458 (2018-12-15)
Aberrant expression of microRNAs (miRNAs) is frequent in various cancers including gliomas. We aimed to characterize the role of miR-16-5p as a candidate tumour suppressor miRNA in gliomas. Real-time PCR-based approaches were used for miRNA and mRNA expression profiling of
Mohammed Ghiboub et al.
Frontiers in immunology, 11, 550769-550769 (2020-10-31)
Histone deacetylases (HDACs) are a group of enzymes that control histone deacetylation and bear potential to direct expression of large gene sets. We determined the effect of HDAC inhibitors (HDACi) on human monocytes and macrophages, with respect to their polarization
Tomoharu Kuboyama et al.
Scientific reports, 7(1), 8641-8641 (2017-08-19)
Following spinal cord injury (SCI), the innate immune response of microglia and infiltrating macrophages clears up cellular debris and promotes tissue repair, but it also inflicts secondary injury from inflammatory responses. Immunomodulation aimed at maximizing the beneficial effects while minimizing
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica