Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU062091

Sigma-Aldrich

MISSION® esiRNA

targeting human NFIA

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TGTTCTTTCCAACCCAGACCAGAAAGGCAAGATGCGAAGAATTGACTGCCTCCGCCAGGCAGATAAAGTCTGGAGGTTGGACCTTGTTATGGTGATTTTGTTTAAAGGTATTCCGCTGGAAAGTACTGATGGCGAGCGCCTTGTAAAGTCCCCACAATGCTCTAATCCAGGGCTCTGTGTCCAACCCCATCACATAGGGGTTTCTGTTAAGGAACTCGATTTATATTTGGCATACTTTGTGCATGCAGCAGATTCAAGTCAATCTGAAAGTCCCAGCCAGCCAAGTGACGCTGACATTAAGGACCAGCCAGAAAATGGACATTTGGGCTTCCAGGACAGTTTTGTCACATCAGGTGTTTTTAGTGTCACTGAGCTAGTAAGAGTGTCACAGACACCAATAGCTGCAGGAACTGGCCCAAATTTTTCTCTCTCAGATTTGGAAAGTTCTTCATACTACAGCATGAGTCCAGGAGCAAT

Ensembl | Número de adesão de ser humano

ENSG00000162599

nº de adesão NCBI

NM_005595

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... NFIA(4774) , NFIA(4774)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Chin-Cheng Lee et al.
PloS one, 12(3), e0173890-e0173890 (2017-03-23)
MicroRNAs are small noncoding RNAs that post-transcriptionally control the expression of genes involved in glioblastoma multiforme (GBM) development. Although miR-302b functions as a tumor suppressor, its role in GBM is still unclear. Therefore, this study comprehensively explored the roles of
Hairui Yuan et al.
Journal of cellular physiology, 236(3), 1810-1821 (2020-07-24)
miR-142a-5p plays critical roles in multiple biological processes and diseases, such as inflammation and tumorigenesis. However, it remains to be explored if and how miR-142a-5p contributes to osteoblast differentiation. In this study, our results showed that miR-142a-5p was highly expressed
Wenxiang Hu et al.
Cell stem cell, 24(2), 299-308 (2019-01-15)
Thiazolidinedione drugs (TZDs) target the transcriptional activity of peroxisome proliferator activated receptor γ (PPARγ) to reverse insulin resistance in type 2 diabetes, but side effects limit their clinical use. Here, using human adipose stem cell-derived adipocytes, we demonstrate that SNPs
Motoshi Nagao et al.
Nature communications, 7, 11102-11102 (2016-03-24)
Multipotent neural precursor cells (NPCs) generate astrocytes at late stages of mammalian neocortical development. Many signalling pathways that regulate astrocytogenesis directly induce the expression of GFAP, a marker of terminally differentiated astrocytes. However, astrocyte specification occurs before GFAP expression and

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica