Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU025841

Sigma-Aldrich

MISSION® esiRNA

targeting human HDAC1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CGAATCCGCATGACTCATAATTTGCTGCTCAACTATGGTCTCTACCGAAAAATGGAAATCTATCGCCCTCACAAAGCCAATGCTGAGGAGATGACCAAGTACCACAGCGATGACTACATTAAATTCTTGCGCTCCATCCGTCCAGATAACATGTCGGAGTACAGCAAGCAGATGCAGAGATTCAACGTTGGTGAGGACTGTCCAGTATTCGATGGCCTGTTTGAGTTCTGTCAGTTGTCTACTGGTGGTTCTGTGGCAAGTGCTGTGAAACTTAATAAGCAGCAGACGGACATCGCTGTGAATTGGGCTGGGGGCCTGCACCATGCAAAGAAGTCCGAGGCATCTGGCTTCTGTTACGTCAATGATATCGTCTTGGCCATCCTGGAACTGCTAAAGTATCACCAGAGGGTGCTGTACA

Ensembl | Número de adesão de ser humano

ENSG00000116478

nº de adesão NCBI

NM_004964

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... HDAC1(3065) , HDAC1(3065)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
PPU
XUT
WUT
ZKT
QCT

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Yutao Yang et al.
Molecular neurobiology, 53(2), 1266-1278 (2015-04-16)
POK erythroid myeloid ontogenic factor (Pokemon), an important proto-oncoprotein, is a transcriptional repressor that regulates the expression of many genes and plays an important role in tumorigenesis. Resveratrol (RSV), a natural polyphenolic compound, has many beneficial biological effects on health.
Shiladitya Sengupta et al.
Oncotarget, 7(46), 75197-75209 (2016-09-23)
Apurinic/apyrimidinic (AP) sites are frequently generated in the genome by spontaneous depurination/depyrimidination or after removal of oxidized/modified bases by DNA glycosylases during the base excision repair (BER) pathway. Unrepaired AP sites are mutagenic and block DNA replication and transcription. The
Xiaohua Yan et al.
Journal of molecular cell biology, 10(1), 48-59 (2017-10-17)
Evading TGF-β-mediated growth inhibition is often associated with tumorigenesis in liver, including hepatocellular carcinoma (HCC). To better understand the functions and the underlying molecular mechanisms of TGF-β in HCC initiation and progression, we carried out transcriptome sequencing (RNA-Seq) to identify
Baojie Zhang et al.
Cancers, 11(5) (2019-05-15)
Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) is considered as a promising anti-cancer therapeutic. However, many cancers have been found to be or to become inherently resistant to TRAIL. A combination of epigenetic modifiers, such as histone deacetylase inhibitors (HDACi's), with
Jing Yang et al.
Scientific reports, 7, 43864-43864 (2017-03-07)
Hepatocellular carcinoma (HCC) is one of the most commonly diagnosed cancers in the world. Elevated glucose metabolism in the availability of oxygen, a phenomenon called the Warburg effect, is important for cancer cell growth. Fructose-1,6-bisphosphatase (FBP1) is a rate-limiting enzyme
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica