Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

View All Documentation

EHU008751

Sigma-Aldrich

MISSION® esiRNA

targeting human EPAS1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GGGCCAGGTGAAAGTCTACAACAACTGCCCTCCTCACAATAGTCTGTGTGGCTACAAGGAGCCCCTGCTGTCCTGCCTCATCATCATGTGTGAACCAATCCAGCACCCATCCCACATGGACATCCCCCTGGATAGCAAGACCTTCCTGAGCCGCCACAGCATGGACATGAAGTTCACCTACTGTGATGACAGAATCACAGAACTGATTGGTTACCACCCTGAGGAGCTGCTTGGCCGCTCAGCCTATGAATTCTACCATGCGCTAGACTCCGAGAACATGACCAAGAGTCACCAGAACTTGTGCACCAAGGGTCAGGTAGTAAGTGGCCAGTACCGGATGCTCGCAAAGCATGGGGGCTACGTGTGGCTGGAGACCCAGGGGACGGTCATCTACAACCCTCGCAACCTGCAGCCCCAGTGCATCATGTGTGTCA

Ensembl | Número de adesão de ser humano

ENSG00000116016

nº de adesão NCBI

NM_001430

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... EPAS1(2034) , EPAS1(2034)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Seungyeul Yoo et al.
PLoS genetics, 11(1), e1004898-e1004898 (2015-01-09)
Chronic Obstructive Pulmonary Disease (COPD) is a complex disease. Genetic, epigenetic, and environmental factors are known to contribute to COPD risk and disease progression. Therefore we developed a systematic approach to identify key regulators of COPD that integrates genome-wide DNA
Olga Roche et al.
Nucleic acids research, 44(19), 9315-9330 (2016-11-02)
A wide range of diseases course with an unbalance between the consumption of oxygen by tissues and its supply. This situation triggers a transcriptional response, mediated by the hypoxia inducible factors (HIFs), that aims to restore oxygen homeostasis. Little is
Shirley Dehn et al.
Journal of immunology (Baltimore, Md. : 1950), 197(9), 3639-3649 (2016-09-28)
Hypoxia-inducible factor (HIF)-α isoforms regulate key macrophage (MΦ) functions during ischemic inflammation. HIF-2α drives proinflammatory cytokine production; however, the requirements for HIF-2α during other key MΦ functions, including phagocytosis, are unknown. In contrast to HIF-1α, HIF-2α was not required for
Maria Lucibello et al.
Oncotarget, 6(7), 5275-5291 (2015-03-18)
Upregulation of Translationally Controlled Tumor Protein (TCTP) is associated with poorly differentiated aggressive tumors, including breast cancer, but the underlying mechanism(s) are still debated. Here, we show that in breast cancer cell lines TCTP is primarily localized in the nucleus

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica