Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

Visualizar Toda a Documentação

EHU008731

Sigma-Aldrich

MISSION® esiRNA

targeting human NR4A2

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CCCAGTGGAGGGTAAACTCATCTTTTGCAATGGGGTGGTCTTGCACAGGTTGCAATGCGTTCGTGGCTTTGGGGAATGGATTGATTCCATTGTTGAATTCTCCTCCAACTTGCAGAATATGAACATCGACATTTCTGCCTTCTCCTGCATTGCTGCCCTGGCTATGGTCACAGAGAGACACGGGCTCAAGGAACCCAAGAGAGTGGAAGAACTGCAAAACAAGATTGTAAATTGTCTCAAAGACCACGTGACTTTCAACAATGGGGGGTTGAACCGCCCCAATTATTTGTCCAAACTGTTGGGGAAGCTCCCAGAACTTCGTACCCTTTGCACACAGGGGCTACAGCGCATTTTCTACCTGAAATTGGAAGACTTGGTGCCACCGCCAGCAATAATTGACAAACTTTTCCTGGACACTTTACCTTTCTAAGACCTCCTCCCAAGCACTTCAAAGGAACTGGAATGATAATGGAAACTGTCAAGAGGGGGCAAGTCACATGGGCAGAGATAGCCGTGTGAGCAGTCTCAGCTC

Ensembl | Número de adesão de ser humano

ENSG00000153234

nº de adesão NCBI

NM_006186

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... NR4A2(4929) , NR4A2(4929)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

12 - Non Combustible Liquids

Classe de risco de água (WGK)

WGK 1

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Shawn Llopis et al.
BMC cancer, 13, 139-139 (2013-03-23)
NR4A orphan nuclear receptors are involved in multiple biological processes which are important in tumorigenesis such as cell proliferation, apoptosis, differentiation, and glucose utilization. The significance of NR4A family member NURR1 (NR4A2) in breast cancer etiology has not been elucidated.
Hye-Sun Lim et al.
Oxidative medicine and cellular longevity, 2019, 5797512-5797512 (2019-11-28)
Parkinson's disease (PD) is characterized by dopaminergic neuronal loss in the substantia nigra pars compacta (SNPC) and the striatum. Nuclear receptor-related 1 protein (Nurr1) is a nuclear hormone receptor implicated in limiting mitochondrial dysfunction, apoptosis, and inflammation in the central
Xin Heng et al.
Molecular neurodegeneration, 7, 4-4 (2012-02-03)
NURR1 (also named as NR4A2) is a member of the steroid/thyroid hormone receptor family, which can bind to DNA and modulate expression of target genes. Previous studies have shown that NURR1 is essential for the nigral dopaminergic neuron phenotype and
S Loppi et al.
Brain, behavior, and immunity, 73, 670-681 (2018-08-01)
Ischemic stroke is amongst the leading causes of death and disabilities. The available treatments are suitable for only a fraction of patients and thus novel therapies are urgently needed. Blockage of one of the cerebral arteries leads to massive and
Hiroki Shimada et al.
FEBS open bio, 7(9), 1410-1421 (2017-09-15)
Aldosterone synthase is the key rate-limiting enzyme in adrenal aldosterone production, and induction of its gene (
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica