Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

Visualizar Toda a Documentação

EHU002271

Sigma-Aldrich

MISSION® esiRNA

targeting human LEF1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CCAGATGGAGGCCTCTACAACAAGGGACCCTCCTACTCGAGTTATTCCGGGTACATAATGATGCCAAATATGAATAACGACCCATACATGTCAAATGGATCTCTTTCTCCACCCATCCCGAGAACATCAAATAAAGTGCCCGTGGTGCAGCCATCCCATGCGGTCCATCCTCTCACCCCCCTCATCACTTACAGTGACGAGCACTTTTCTCCAGGATCACACCCGTCACACATCCCATCAGATGTCAACTCCAAACAAGGCATGTCCAGACATCCTCCAGCTCCTGATATCCCTACTTTTTATCCCTTGTCTCCGGGTGGTGTTGGACAGATCACCCCACCTCTTGGCTGGCAAGGTCAGCCTGTATATCCCATCACGGGTGGATTCAGGCAACCCTACCCATCCTCACTGTCAGTCGACACTTCCATGTCCAGGTTTTCCCATCATATGATTCCCGGTCCTCCTGGTCCCCACACAACTGGCATCCCTCATCCAGCTATTGTAACACCTCAGGTCAAACAGGAACATCCCCACACTGACAGTGACCTAATGCACGTGAAGCCTCA

Ensembl | Número de adesão de ser humano

ENSG00000138795

nº de adesão NCBI

NM_016269

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... LEF1(51176) , LEF1(51176)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

12 - Non Combustible Liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
QCS
CGT
AYS
WNS
KLS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Rhys G Morgan et al.
Haematologica, 104(7), 1365-1377 (2019-01-12)
Canonical Wnt/β-catenin signaling is frequently dysregulated in myeloid leukemias and is implicated in leukemogenesis. Nuclear-localized β-catenin is indicative of active Wnt signaling and is frequently observed in acute myeloid leukemia (AML) patients; however, some patients exhibit little or no nuclear
Yaoyao Chen et al.
Stem cell reports, 1(3), 209-217 (2013-12-10)
Germline-competent embryonic stem cells (ESCs) have been derived from mice and rats using culture conditions that include an inhibitor of glycogen synthase kinase 3 (GSK3). However, rat ESCs remain susceptible to sporadic differentiation. Here, we show that unsolicited differentiation is
Julia Dräger et al.
Oncotarget, 8(2), 3259-3273 (2016-12-15)
Rhabdomyosarcoma (RMS) is the most common soft tissue sarcoma in children and show characteristics of skeletal muscle differentiation. The two major RMS subtypes in children are alveolar (ARMS) and embryonal RMS (ERMS). We demonstrate that approximately 50% of ARMS and
P Wu et al.
Cell death & disease, 5, e1085-e1085 (2014-03-01)
Inhibitor-of-apoptosis protein (IAP) inhibitors have been reported to synergistically reduce cell viability in combination with a variety of chemotherapeutic drugs via targeted cellular IAP (cIAP) depletion. Here, we found that cIAP silencing sensitised colorectal cancer (CRC) cells to selenite-induced apoptosis.
Xinyu Wang et al.
Journal of Cancer, 11(10), 3072-3081 (2020-04-01)
Background: Our previous studies reported that lymphoid enhancer-binding factor 1 (LEF1) was upregulated in esophageal squamous cell carcinoma (ESCC) and the positive expression of LEF1 was correlated with aberrant clinicopathological characteristics in ESCC patients. However, the upstream mechanism of regulating
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica