Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

Visualizar Toda a Documentação

EHU001391

Sigma-Aldrich

MISSION® esiRNA

targeting human TMEM131

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GGTCCAAGGACAAGGAACAACTGAGAACTTGAGGGTGGCAGGCAAGCTTCCAGGTCCAGGAAGCTCCTTACGCTTTAAAATCACGGAAGCATTGTTAAAAGATTGTACAGATAGTTTAAAACTAAGAGAACCAAATTTCACATTGAAAAGAACATTTAAGGTAGAGAATACAGGACAACTTCAAATTCACATAGAAACCATTGAAATCAGTGGATACTCATGTGAAGGATATGGCTTTAAAGTTGTTAATTGTCAAGAGTTTACTCTAAGTGCCAATGCTTCTAGAGATATAATCATATTGTTTACTCCTGATTTTACAGCTTCTAGAGTTATTCGGGAACTGAAGTTTATAACAACCAGTGGCTCTGAGTTTGTATTTATATTGAATGCATCCCTTCCTTACCATATGTTAGCAACCTGTGCAGAAGCCCTACCCAGACCT

Ensembl | Número de adesão de ser humano

ENSG00000075568

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... TMEM131(23505) , TMEM131(23505)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Chao Wang et al.
Journal of cellular biochemistry, 119(2), 1646-1658 (2017-08-05)
The study elucidated the effects associated with silencing growth factor-β R1 (TGF-β R1) and TGF-β R2 genes on the proliferation and apoptosis of penile urethral epithelial cells (UECs) in hypospadiac male rats. Seventy-five male rats were distributed into the normal
Karl E Carlström et al.
Nature communications, 11(1), 4071-4071 (2020-08-15)
Arrest of oligodendrocyte (OL) differentiation and remyelination following myelin damage in multiple sclerosis (MS) is associated with neurodegeneration and clinical worsening. We show that Glutathione S-transferase 4α (Gsta4) is highly expressed during adult OL differentiation and that Gsta4 loss impairs
Yanjie Zhang et al.
Ecotoxicology and environmental safety, 179, 222-231 (2019-05-03)
Hydrogen sulfide (H2S), a multifunctional gasotransmitter, participates in a wide range of cellular signal transduction and pathophysiological processes. Cystathionine gamma-lyase (CSE) acts as a major H2S-generating enzyme in peripheral organs and tissues. As a cysteine-rich and heavy metal-binding protein, metallothionein-1
Yoav Elkis et al.
Nature communications, 8(1), 940-940 (2017-10-19)
Disruption of the reprogrammed energy management system of malignant cells is a prioritized goal of targeted cancer therapy. Two regulators of this system are the Fer kinase, and its cancer cell specific variant, FerT, both residing in subcellular compartments including
Shigemi Kimura et al.
Scientific reports, 4, 5066-5066 (2014-06-12)
The ZHTc6-MyoD embryonic stem cell line expresses the myogenic transcriptional factor MyoD under the control of a tetracycline-inducible promoter. Following induction, most of the ZHTc6-MyoD cells differentiate to myotubes. However, a small fraction does not differentiate, instead forming colonies that
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica