Direkt zum Inhalt
Merck

EHU109591

Sigma-Aldrich

MISSION® esiRNA

targeting human PHB

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GGCTGAGCAACAGAAAAAGGCGGCCATCATCTCTGCTGAGGGCGACTCCAAGGCAGCTGAGCTGATTGCCAACTCACTGGCCACTGCAGGGGATGGCCTGATCGAGCTGCGCAAGCTGGAAGCTGCAGAGGACATCGCGTACCAGCTCTCACGCTCTCGGAACATCACCTACCTGCCAGCGGGGCAGTCCGTGCTCCTCCAGCTGCCCCAGTGAGGGCCCACCCTGCCTGCACCTCCGCGGGCTGACTGGGCCACAGCCCCGATGATTCTTAACACAGCCTTCCTTCTGCTCCCACCCCAGAAATCACTGTGAAATTTCATGATTGGCTTAAAGTGAAGGAAATAAAGGTAAAATCACTTCAGATCTCTAATTAGTCTATCAAATGAAACTCTTTCATTCTTCTCACATCCATCTACTTTTTTATCCACCTCCCTACCAAAAATTGCCAAGTGCCTATGCAAACCAGCT

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Lijun Sun et al.
Biochemical and biophysical research communications, 513(2), 446-451 (2019-04-11)
Influenza virus infection is associated with type 1 diabetes (T1DM), but its pathogenesis remains unclear. Here, our study found that one of the monoclonal antibodies against H1N1 influenza virus hemagglutinin(HA) cross-reacted with human pancreatic tissue and further demonstrated that it
Debabrata Chowdhury et al.
Molecular and cellular biochemistry, 425(1-2), 155-168 (2016-11-18)
Numerous hypertrophic stimuli, including β-adrenergic agonists such as isoproterenol (ISO), result in generation of reactive oxygen species (ROS) and alteration in the mitochondrial membrane potential (Δψ) leading to oxidative stress. This process is well associated with phosphorylation of thymoma viral
Kinnosuke Yahiro et al.
Cellular microbiology, 21(8), e13033-e13033 (2019-04-23)
Vibrio cholerae produced-Cholix toxin (Cholix) is a cytotoxin that ADP-ribosylates eukaryotic elongation factor 2, inhibiting protein synthesis, and inducing apoptosis. Here, we identified prohibitin (PHB) 1 and 2 as novel Cholix-interacting membrane proteins in immortalised human hepatocytes and HepG2 cells
Hajime Yurugi et al.
Journal of cell science, 133(12) (2020-06-06)
The RAS oncogenes are frequently mutated in human cancers and among the three isoforms (KRAS, HRAS and NRAS), KRAS is the most frequently mutated oncogene. Here, we demonstrate that a subset of flavaglines, a class of natural anti-tumour drugs and
Satomi Miwa et al.
Nature communications, 5, 3837-3837 (2014-05-13)
Mitochondrial function is an important determinant of the ageing process; however, the mitochondrial properties that enable longevity are not well understood. Here we show that optimal assembly of mitochondrial complex I predicts longevity in mice. Using an unbiased high-coverage high-confidence

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.