EHUEGFP
MISSION® esiRNA
targeting EGFP
Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)
About This Item
UNSPSC-Code:
41105324
NACRES:
NA.51
Empfohlene Produkte
Beschreibung
Powered by Eupheria Biotech
Produktlinie
MISSION®
Form
lyophilized powder
Versandbedingung
ambient
Lagertemp.
−20°C
Allgemeine Beschreibung
EHUEGFP ist spezifisch für das grün fluoreszierende Protein eGFP (enhanced Green Fluorescent Protein). Es kann als Negativkontrolle in Systemen mit fehlendem eGFP oder als Positivkontrolle in Systemen, die das eGFP exprimieren, verwendet werden.
MISSION® esiRNA ist durch Endoribonuklease hergestellte siRNA. Dabei handelt es sich um eine heterogene Mischung von siRNA, die alle dieselbe mRNA-Zielsequenz haben. Diese mehrfachen Auslöser bewirken eine hochspezifische und wirksame Genstummschaltung.
Weitere Einzelheiten sowie eine Darstellung aller erhältlichen esiRNA-Produkte finden Sie unter SigmaAldrich.com/esiRNA.
Weitere Einzelheiten sowie eine Darstellung aller erhältlichen esiRNA-Produkte finden Sie unter SigmaAldrich.com/esiRNA.
Sonstige Hinweise
esiRNA-cDNA-Zielsequenz: GTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTA
Rechtliche Hinweise
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Lagerklassenschlüssel
10 - Combustible liquids
Flammpunkt (°F)
Not applicable
Flammpunkt (°C)
Not applicable
Hier finden Sie alle aktuellen Versionen:
Besitzen Sie dieses Produkt bereits?
In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.
Kunden haben sich ebenfalls angesehen
Shalaka Chitale et al.
Nucleic acids research, 45(10), 5901-5912 (2017-04-13)
Repair of damaged DNA relies on the recruitment of DNA repair factors in a well orchestrated manner. As a prerequisite, the chromatin needs to be decondensed by chromatin remodelers to allow for binding of repair factors and for DNA repair
Lin Zhou et al.
Zygote (Cambridge, England), 24(1), 89-97 (2015-02-13)
ING2 (inhibitor of growth protein-2) is a member of the ING-gene family and participates in diverse cellular processes involving tumor suppression, DNA repair, cell cycle regulation, and cellular senescence. As a subunit of the Sin3 histone deacetylase complex co-repressor complex
Aman Kumar et al.
Molecular biology reports, 47(9), 7273-7276 (2020-08-06)
NLRP3 pathway plays a vital role in the pathogenesis of different human cancers but still the regulation of NLRP3 pathway largely unknown. Therefore, we examined the levels of NLRP3 and its downstream components (caspase-1 and IL-1β) and its relationship with
Milica Momcilovic et al.
Cancer cell, 33(5), 905-921 (2018-05-16)
Altered metabolism is a hallmark of cancer growth, forming the conceptual basis for development of metabolic therapies as cancer treatments. We performed in vivo metabolic profiling and molecular analysis of lung squamous cell carcinoma (SCC) to identify metabolic nodes for therapeutic
Aman Kumar et al.
Scientific reports, 9(1), 8189-8189 (2019-06-05)
Renal cell carcinoma (RCC) is the leading cause among cancer-related deaths due to urological cancers, which results in response to combination of genetic and epigenetic factors. Histone methylations have been implicated in renal tumorigenesis but their clinical significance and underlying
Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..
Setzen Sie sich mit dem technischen Dienst in Verbindung.