Direkt zum Inhalt
Merck

EMU088231

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Yap1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CACACTGGAAGGAGATGCAATGAACATAGAAGGGGAGGAGCTGATGCCCAGTCTGCAGGAAGCGCTGAGTTCCGAAATCTTGGACGTGGAGTCTGTGTTGGCTGCCACCAAGCTAGATAAAGAAAGCTTTCTCACGTGGTTATAGAGCTGCAGGGAGCCACTCTGAGTCTGTGAGGGATCCACAGAGCCTAAGATGTGCACGCCTGAAATTCAGATAAGTCAGTGGGGGTTCTCTGGCTAACACAGAAAACAGATGAACCAGTGTCCATCGTTGTTCCGCTTTTCTCTGCCCGTCGCTGCTCTTACGTTGGTTGCTGACCTCTTCACGGCCGGCTCTAAAGAACCCGAACCGCAGACAGATTCCTTTGTTAACTCTGCTATGATAACTACGTTCTCTGGGATTGCTGGGGGATGGCCTGCTGGATAATGGATGTTCTGCCTTTTGTCCGGTGGTCCTTTCACCATCACTTTAACTGAACACACAGACTGGGAACTGAATGCTCTAGAACATTGTTCAAGAGGTGGTTTCTTCAGCTGC

Ensembl | Maus Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Lise Lotte Christensen et al.
PloS one, 9(6), e96767-e96767 (2014-06-04)
MicroRNAs (miRNAs) play a critical role in many biological processes and are aberrantly expressed in human cancers. Particular miRNAs function either as tumor suppressors or oncogenes and appear to have diagnostic and prognostic significance. Although numerous miRNAs are dys-regulated in
Erica Lorenzetto et al.
Oncotarget, 5(9), 2608-2621 (2014-05-09)
The transcriptional coactivator YAP1 is a critical effector of the human Salvador-Warts-Hippo pathway. Literature data report apparently discrepant results on the carcinogenic role of YAP1, which acts either as oncogene or as tumor suppressor in different in vitro and in
Hyun-Jung Choi et al.
Nature communications, 6, 6943-6943 (2015-05-13)
Angiogenesis is regulated by the dynamic interaction between endothelial cells (ECs). Hippo-Yes-associated protein (YAP) signalling has emerged as a key pathway that controls organ size and tissue growth by mediating cell contact inhibition. However, the role of YAP in EC
David Fu et al.
Endocrine-related cancer, 21(2), 297-310 (2014-01-07)
The Hippo signaling pathway has been implicated as a conserved regulator of organ size in both Drosophila and mammals. Yes-associated protein (YAP), the central component of the Hippo signaling cascade, functions as an oncogene in several malignancies. Ovarian granulosa cell
C He et al.
Oncogene, 34(50), 6040-6054 (2015-03-24)
Mechanisms underlying ovarian cancer initiation and progression are unclear. Herein, we report that the Yes-associated protein (YAP), a major effector of the Hippo tumor suppressor pathway, interacts with ERBB signaling pathways to regulate the initiation and progression of ovarian cancer.

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.