Direkt zum Inhalt
Merck
Alle Fotos(1)

Wichtige Dokumente

EHU069421

Sigma-Aldrich

MISSION® esiRNA

targeting human BAX

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

100

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TTTGCTTCAGGGTTTCATCCAGGATCGAGCAGGGCGAATGGGGGGGGAGGCACCCGAGCTGGCCCTGGACCCGGTGCCTCAGGATGCGTCCACCAAGAAGCTGAGCGAGTGTCTCAAGCGCATCGGGGACGAACTGGACAGTAACATGGAGCTGCAGAGGATGATTGCCGCCGTGGACACAGACTCCCCCCGAGAGGTCTTTTTCCGAGTGGCAGCTGACATGTTTTCTGACGGCAACTTCAACTGGGGCCGGGTTGTCGCCCTTTTCTACTTTGCCAGCAAACTGGTGCTCAAGGCTGGCGTGAAATGGCGTGATCTGGGCTCACTGCAACCTCTGCCTCCTGGGTTCAAGCGATTCACCTGCCTCAGCATCCCAAGGAGCTGGGATTACAGGCCCTGTGCACCAAGGTGCCGGAACTGATCAGAACCATCATGGGCTGGACATTGGACTTCCTCC

Ensembl | Human Hinterlegungsnummer

ENSG00000087088

NCBI-Hinterlegungsnummer

NM_138764

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... BAX(581) , BAX(581)

Verwandte Kategorien

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Ilaria Penna et al.
Oncotarget, 7(4), 3947-3965 (2015-12-19)
Intrinsic cross-resistance to inhibition of different signaling pathways may hamper development of combinatorial treatments in melanoma, but the relative frequency of this phenotype and the strategies to overcome this hurdle remain poorly understood. Among 49 BRAF-mutant melanoma cell lines from
Li-han Zhang et al.
Apoptosis : an international journal on programmed cell death, 21(4), 473-488 (2016-01-16)
Epirubicin (EPI) is widely used for triple negative breast cancer (TNBC), but a substantial number of patients develop EPI resistance that is associated with poor outcome. The underlying mechanism for EPI resistance remains poorly understood. We have developed and characterized
Chia-Hui Huang et al.
Toxicology and applied pharmacology, 334, 35-46 (2017-09-05)
Quinacrine, which is clinically used as an antimalarial drug, has anti-cancer activity. However, mechanism underlying its cytotoxic effect remains to be completely elucidated. In the present study, we investigated the cytotoxic effect of quinacrine on human leukemia U937 cells. Quinacrine-induced
Z T Gu et al.
Scientific reports, 5, 11497-11497 (2015-06-25)
In this study, We demonstrated that Bax mitochondrial translocation plays a vital role in the initiation of the mitochondrial signaling pathway upon activation by heat stress. In addition, both p53 mitochondrial translocation and Ca(2+) signal mediated MPTP opening activate Bax
Bhaskar Saha et al.
Oncotarget, 8(43), 73905-73924 (2017-11-02)
In view of the inadequacy of neuroblastoma treatment, five hydroxystilbenes and resveratrol (Resv) were screened for their cytotoxic property against human neuroblastoma cell lines. The mechanism of cytotoxic action of the most potent compound
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.