Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Key Documents

EMU090241

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Hdac3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCTGGTAGAAGAGGCCATTAGTGAGGAACTTCCCTATAGTGAATACTTCGAGTACTTTGCCCCAGATTTCACACTCCATCCAGATGTCAGCACCCGCATCGAGAATCAGAACTCACGCCAGTATCTGGACCAGATCCGCCAGACAATCTTTGAAAACTTGAAGATGCTGAACCATGCACCCAGTGTCCAGATTCATGATGTCCCGGCAGACCTCCTGACGTATGACAGGACTGACGAGGCCGACGCTGAAGAGAGAGGTCCCGAGGAGAACTACAGCAGGCCAGAAGCACCCAATGAGTTCTATGATGGCGACCATGACAACGACAAGGAAAGTTGATGTGGAGATTTAGAGCAGCATGGATGCTGTGTCCCAAGAGTTCCTTGTCACCTCTGTGGTGGGAAGGAAAGTATGGTTTCCCCAGGTCTGAACTGGGTACCCCCAGGGTGTTTACTAACTCTGGTGAAGGGTTTGGAAACCATATGTGGTTCTAGAATTAACTCCCTTTCCTCAAACTCTCACGGCCTGATGATTGTCCCTCTCAGGGATGAGACATGGACA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Olga S Safronova et al.
Nucleic acids research, 42(14), 8954-8969 (2014-07-25)
Hypoxia is associated with a variety of physiological and pathological conditions and elicits specific transcriptional responses. The elongation competence of RNA Polymerase II is regulated by the positive transcription elongation factor b (P-TEFb)-dependent phosphorylation of Ser2 residues on its C-terminal
S S Roy et al.
Oncogene, 33(28), 3707-3716 (2013-08-27)
Tumor metastasis is the leading cause of death among breast cancer patients. PELP1 (proline, glutamic acid and leucine rich protein 1) is a nuclear receptor coregulator that is upregulated during breast cancer progression to metastasis and is an independent prognostic
Takuya Yashiro et al.
PloS one, 10(9), e0137699-e0137699 (2015-09-12)
The transcription factor PU.1 is predominantly expressed in dendritic cells (DCs) and is essential for DC differentiation. Although there are several reports that PU.1 positively regulates the expression of DC-specific genes, whether PU.1 also has a suppressive effect on DCs

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico