Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU035111

Sigma-Aldrich

MISSION® esiRNA

targeting human PHGDH

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTCATCAACGCAGCTGAGAAACTCCAGGTGGTGGGCAGGGCTGGCACAGGTGTGGACAATGTGGATCTGGAGGCCGCAACAAGGAAGGGCATCTTGGTTATGAACACCCCCAATGGGAACAGCCTCAGTGCCGCAGAACTCACTTGTGGAATGATCATGTGCCTGGCCAGGCAGATTCCCCAGGCGACGGCTTCGATGAAGGACGGCAAATGGGAGCGGAAGAAGTTCATGGGAACAGAGCTGAATGGAAAGACCCTGGGAATTCTTGGCCTGGGCAGGATTGGGAGAGAGGTAGCTACCCGGATGCAGTCCTTTGGGATGAAGACTATAGGGTATGACCCCATCATTTCCCCAGAGGTCTCGGCCTCCTTTGGTGTTCAGCAGCTGCCCCTGGAGGAGATCTGGCCTCTCTGTGATTTCATCACTGTGCACACTCCTCTCCTGCCCTCCACGACAGGCTTGCTGAATGACA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Wen-Bin Guo et al.
Reproductive biology and endocrinology : RB&E, 18(1), 70-70 (2020-07-16)
Although varicocele is considered to be one of the leading causes of male infertility, the precise mechanism underlying how varicocele leads to male infertility is not completely understood. We found the lactate concentration on the varicocele side of the patients
Mai Q Nguyen et al.
The Journal of investigative dermatology, 140(11), 2242-2252 (2020-05-12)
Melanomas frequently harbor activating NRAS mutations leading to activation of MAPK kinase (MEK) and extracellular signal-regulated kinase 1/2 signaling; however, the clinical efficacy of inhibitors to this pathway is limited by resistance. Tumors rewire metabolic pathways in response to stress
Florence Polet et al.
Oncotarget, 7(2), 1765-1776 (2015-12-02)
Leukemia cells are described as a prototype of glucose-consuming cells with a high turnover rate. The role of glutamine in fueling the tricarboxylic acid cycle of leukemia cells was however recently identified confirming its status of major anaplerotic precursor in
Samah Elsaadi et al.
Experimental hematology & oncology, 10(1), 3-3 (2021-01-06)
Multiple myeloma (MM) is a hematological malignancy characterized by the clonal expansion of plasma cells in the bone marrow. To date, this disease is still incurable and novel therapeutic approaches are required. Phosphoglycerate dehydrogenase (PHGDH) is the first and rate-limiting
Amit Subedi et al.
FEBS letters, 593(8), 763-776 (2019-03-16)
Differences in the metabolism of cancer cells or cancer stem cells (CSCs) as compared to normal cells have provided avenues to safely target cancers. To discover metabolic inhibitors of CSCs, we performed alkaline phosphatase- and tumoursphere-based drug screening using induced

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico