Saltar al contenido
MilliporeSigma

EHU013561

Sigma-Aldrich

MISSION® esiRNA

targeting human MSH2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTCATGGCTGAAATGTTGGAAACTGCTTCTATCCTCAGGTCTGCAACCAAAGATTCATTAATAATCATAGATGAATTGGGAAGAGGAACTTCTACCTACGATGGATTTGGGTTAGCATGGGCTATATCAGAATACATTGCAACAAAGATTGGTGCTTTTTGCATGTTTGCAACCCATTTTCATGAACTTACTGCCTTGGCCAATCAGATACCAACTGTTAATAATCTACATGTCACAGCACTCACCACTGAAGAGACCTTAACTATGCTTTATCAGGTGAAGAAAGGTGTCTGTGATCAAAGTTTTGGGATTCATGTTGCAGAGCTTGCTAATTTCCCTAAGCATGTAATAGAGTGTGCTAAACAGAAAGCCCTGGAACTTGAGGAGTTTCAGTATATTGGAGAATCGCAAGGATATGATATCATGGAACCAGCAGCAAAGAAGTGCTATCTGGAAAGAGAGCAAGGTGAAAAAATTATTCAGGAGTTCCTGTCCAAGGTGAAACAAATGCCCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Lidia Cerquetti et al.
Cancers, 11(11) (2019-11-14)
Mitotane (MTT) is an adrenolytic drug used in adjuvant and advanced treatments of adrenocortical carcinoma (ACC). Ionizing radiation (IR) is also used in adrenal cancer treatment, even though its biological action remains unknown. To provide a reliable in vivo preclinical
Jennifer A McKinney et al.
Nature communications, 11(1), 236-236 (2020-01-15)
Alternative DNA structure-forming sequences can stimulate mutagenesis and are enriched at mutation hotspots in human cancer genomes, implicating them in disease etiology. However, the mechanisms involved are not well characterized. Here, we discover that Z-DNA is mutagenic in yeast as
Alaina R Martinez et al.
Genes, chromosomes & cancer, 56(8), 617-631 (2017-04-12)
Cancer cells require telomere maintenance to enable uncontrolled growth. Most often telomerase is activated, although a subset of human cancers are telomerase-negative and depend on recombination-based mechanisms known as ALT (Alternative Lengthening of Telomeres). ALT depends on proteins that are
Min Peng et al.
The EMBO journal, 33(15), 1698-1712 (2014-06-27)
Several proteins in the BRCA-Fanconi anemia (FA) pathway, such as FANCJ, BRCA1, and FANCD2, interact with mismatch repair (MMR) pathway factors, but the significance of this link remains unknown. Unlike the BRCA-FA pathway, the MMR pathway is not essential for
Daniel J McGrail et al.
Cancer cell, 37(3), 371-386 (2020-02-29)
Deficient DNA mismatch repair (dMMR) induces a hypermutator phenotype that can lead to tumorigenesis; however, the functional impact of the high mutation burden resulting from this phenotype remains poorly explored. Here, we demonstrate that dMMR-induced destabilizing mutations lead to proteome

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico